Sol Genomics Network

Unigene SGN-U277688

Unigene Basic Information

Unigene ID:	SGN-U277688
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	277688
mRNA sequence:	Length: 562 bp

>SGN-U277688 Solanum tuberosum #4 (4 members)
AGAAGGCGATACAAGATGAACAAAAAGGAAGTGTTTAAGCTAGCTAAAGGGTTTCGAGGAAGAGCTAAAAACTGCATAAGAATAGCTAGA
GAAAGAGTGGAGAAGGCGCTTCAGTACTCATATAGAGACCGCCGCAACAAGAAGAGGGATATGCGTTCTCTCTGGATTCAACGCATCAAT
GCCGGAACTCGCCAACATGGGGTGAATTATGGCAATTTCATGCACGGGCTGATGAAGGAGAACGTACAGCTGAACAGGAAAGTCTTGTCA
GAACTGTCGATGCACGAACCATACAGCTTCAAGGCCCTTGTGGACGTCTCTCGCAGCGCTTTCCCTGGGAATAAGAAGTCCATAGTACCT
CCAAAGAAGGAAGGGCTTGCTATTGTTCTTTGAATTAATTTCCTATGTTGTGCTTTGTGTACTCTTTTTCTTCTATTTTGGGCATAATTT
TGTGCTAGCATTTCTGTTAGCAAATTTTACCGATAGTATTGAAGTCTCCTGTTTACTGCAAGTGCTTAAATGGAAATTTAATATGCTTTA
ATTTTAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (4)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1
Solanum tuberosum	STOL	Stolon	6462	1
Solanum tuberosum	SWST	Stolon	5942	1
Solanum tuberosum	cPRO	roots in vitro grown stem cuttings	10187	1

mRNA member sequences (4)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	3402	Ribosomal_L20b/o Ribosomal_L20	5
2	26432	Ribosomal_L20b/o Ribosomal_L20	5
5	61333	Ribosomal_L20b/o Ribosomal_L20	4
1.1	103434	Ribosomal protein L20 bacterial and organelle form - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	6
2	121422	Ribosomal protein L20 bacterial and organelle form - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	6
5	132283	Ribosomal protein L20 bacterial and organelle form - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U250764	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: