Sol Genomics Network

Unigene SGN-U291892

Unigene Basic Information

Unigene ID:	SGN-U291892
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	291892
mRNA sequence:	Length: 702 bp

>SGN-U291892 Solanum tuberosum #4 (1 members)
GTCTGACTTAACAAAGGATGACTTCTATGAAGTGAAAAAGAGAGGGTTTAGTGACAGGCAGATAGCTTTTGTGACGAAGTCTAGTGAGCA
GGAGGTTCGGTCGAGGCGTTTGTCTCTGGGTGTGAAACCAGCATATAAACGAGTTGATACATGTGCTGCAAATTTGAGGCTGATACACCT
TATATGTATTCATCTTATGACCTTGAGTGTGAATCAGCTCCTACACAAAAGAAGAAAGTGTTGATTTTAGGTGGAGGACCAAACCGAATT
GGACAGGGCATCGAATTTGATTATTGTTGCTGTCATACATCCTTTGCCCTTCAGGACGCAGGCTATGAAACAATTATGATGAATTCCAAT
CCTGAGACAGTTTCTACAGATTACGACACAAGTGATCGTCTGTACTTTGAACCTCTGACAGTTGAGGATGTTTTTAATATCATCGACTTG
GAAGGACCTGATGGTATCATTGTGCAGTTTGGAGGTCAAACCCCATTGAAATTGGCTCTTCCTATTCAGAATTACTTGGATGAGCGAAGG
CCTAAGAGCAAAAGTGAAGCTGGCTTTGTTAGCATTTGGGGTACATCACCTNGACAACATTGATGCAGCTGAAGATAGGGAGAGGTTCAA
ATGCCATCCTTAATGAACTACAGATCGCTCAGGCAAAAGGGGGTATTGCAAAGAGCGAAAAGGACGCCCTTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	SWST	Stolon	5942	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E560949
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2411	CPase_L_N PurK_ATP CarA_L_glu CPase_L_D3 MGS_like CoA_lig_beta CPase_L_D2 D_ala_D_ala Fe-ADH Dala_lig_Van AccC PurT CPase_L	7
2	24781	CPase_L_N PurK_ATP CarA_L_glu CPase_L_D3 MGS_like CoA_lig_beta CPase_L_D2 D_ala_D_ala Fe-ADH Dala_lig_Van AccC PurT CPase_L	7
5	58810	CPase_L_N PurK_ATP CarA_L_glu CPase_L_D3 MGS_like CoA_lig_beta CPase_L_D2 D_ala_D_ala Fe-ADH Dala_lig_Van AccC PurT CPase_L	7
1.1	101898	Carbamoyl-phosphate synthetase large chain N-terminal - Biological Process: metabolism (GO:0008152) - Molecular Function: ligase activity (GO:0016874) ATP-grasp fold - Molecular Function: catalytic activity (GO:0003824) Carbamoyl-phosphate synthase L chain ATP-binding - Molecular Function: ATP binding (GO:0005524)	29
2	122103	Carbamoyl-phosphate synthetase large chain N-terminal - Biological Process: metabolism (GO:0008152) - Molecular Function: ligase activity (GO:0016874) MGS-like Carbamoyl-phosphate synthase large subunit glutamine-dependent - Molecular Function: carbamoyl-phosphate synthase activity (GO:0004086) - Biological Process: nitrogen compound metabolism (GO:0006807) Carbamoyl-phosphate synthetase large chain oligomerisation - Molecular Function: carbamoyl-phosphate synthase activity (GO:0004086) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: arginine biosynthesis (GO:0006526) - Biological Process: pyrimidine base biosynthesis (GO:0019856) Carbamoyl-phosphate synthase L chain ATP-binding - Molecular Function: ATP binding (GO:0005524) ATP-grasp fold - Molecular Function: catalytic activity (GO:0003824) Carbamoyl-phosphate synthetase large chain - Molecular Function: carbamoyl-phosphate synthase activity (GO:0004086)	5
5	133243	Carbamoyl-phosphate synthetase large chain N-terminal - Biological Process: metabolism (GO:0008152) - Molecular Function: ligase activity (GO:0016874) MGS-like Carbamoyl-phosphate synthase large subunit glutamine-dependent - Molecular Function: carbamoyl-phosphate synthase activity (GO:0004086) - Biological Process: nitrogen compound metabolism (GO:0006807) Carbamoyl-phosphate synthetase large chain oligomerisation - Molecular Function: carbamoyl-phosphate synthase activity (GO:0004086) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: arginine biosynthesis (GO:0006526) - Biological Process: pyrimidine base biosynthesis (GO:0019856) Carbamoyl-phosphate synthase L chain ATP-binding - Molecular Function: ATP binding (GO:0005524) ATP-grasp fold - Molecular Function: catalytic activity (GO:0003824) Carbamoyl-phosphate synthetase large chain - Molecular Function: carbamoyl-phosphate synthase activity (GO:0004086)	4

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U262443	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: