Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U626760

Unigene Basic Information 
Unigene ID: SGN-U626760
Unigene Build: Coffea canephora #3
Date: 2010-04-15
Organism: C.canephora
Alternative ID: none
mRNA sequence: Length: 105 bp

>SGN-U626760 Coffea canephora #3 (1 members)
TTAATTCCCCAACGGAAAGGACCCCCCCCAGGACGCTCCTACGGCTGCTCGGCAAACCCAGGGAATACTTTGGGGCCCCCCCCCGGGCAG
TTGTCCCATACTTGT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E664379
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (0)None
Preceding Unigenes (1)