This unigene is from an out-of-date build,
Lycopersicon Combined #2
It has been superseded by SGN-U568336 in the current build, Tomato 200607 #2
It has been superseded by SGN-U568336 in the current build, Tomato 200607 #2
Unigene Basic Information |
Unigene ID: | SGN-U163708 |
Unigene Build: | Lycopersicon Combined #2 |
Date: | 2003-08-20 |
Organism: | S.lycopersicum S.habrochaites S.pennellii |
Alternative ID: | 163708 |
mRNA sequence: | Length: 208 bp |
>SGN-U163708 Lycopersicon Combined #2 (1 members)
AGACAAAACACTCTGATTGACAGCGTTATGGTACAAGACTATGCTTGATCACGGTTTACAACACAACTAATTGCCACTACATTCTACCAA
AATAAAACACGCATATTACACGCGCATCCAAACGTTAGGACATAATACATCTTTATCCAACTTGATCCATAAACTACATTTTACATCACC
ACATAACATGAGAAAGTGAACAACCCTA
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
Gene Family (0) |
Preceding Unigenes (0) |