Sol Genomics Network

Unigene SGN-U196226

Unigene Basic Information

Unigene ID:	SGN-U196226
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	196226
mRNA sequence:	Length: 629 bp

>SGN-U196226 Capsicum annuum #1 (18 members)
CTCACATATTAAAACCCCATCAACCCCTTAGTTTTTTTTTTTTTTTTTTTTTTTTCGATCACAAAAGCAACAAACATCATATCTAGTTAT
TAACAATGGCCACTGTCACCTCTGCTGCTGTTGCTATCCCATCTTTCACTGGCCTCAAGGCTTGTGCTTCCTCATCTTCCAGAGTTAGCA
CTGCCTCAGCCAAGGTGGCGACCACCCCGGTCGCCAGATTGGCCGTTAAGGCGTCTTTGAAAGACGTTGGTGCTGTCGTTATTGCGACAG
CTGCAAGCGCGATGCTCGCTAGCAATGCGATGGCTATTGAAGTGTTGCTTGGTGGTGATGATGGAAGCCTTGCTTTTGTTCCTGGAACCT
TCAGCGTTAACTCTGGTGAGACAATTACATTCAAGAACAATGCCGGGTTCCCCCACAACGTCGTATTCGATGAAGATGAAATCCCAGCTG
GTGTGGATGCAAGTAAGATTTCAATGGGTGAAGAGGATCTTCTGAATGCACCAGGAGAGACTTACAGTGTCACTTTGAGTGAGAAAGGAA
CCTACAGTTTCTATTGTTCTCCTCACGCGGGAGCTGGAATGAAGGGCCAAGTCACTGTTAACTAATTTTTGTCACCTCTATATCATGTA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (3)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	8
Capsicum annuum	KS09	Young fruit (0.5-2 cm)	4055	9
Capsicum annuum	KS11	Early root	2168	1

mRNA member sequences (18)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1400	BlueCu_1 Plastocyanin Copper_blue	13
2	23477	BlueCu_1 Plastocyanin Copper_blue	12
5	57555	BlueCu_1 Plastocyanin Copper_blue	12
1.1	102572	Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118)	12
2	119779	Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin	12
5	130104	Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin	12

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: