Sol Genomics Network

Unigene SGN-U197488

Unigene Basic Information

Unigene ID:	SGN-U197488
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	197488
mRNA sequence:	Length: 587 bp

>SGN-U197488 Capsicum annuum #1 (3 members)
CTTTGATTAAGCTCAAATGGGGTGGAAAAGTTATCAGAAACTCATTCATCAGTGGAGAATTCTCAGAGGAGATAATGTCATGATTATCAG
AGGAAAAGATAAAGGCGAGACTGGTATCGTTAAGCGTGTCGTACGTTCTCAAAACCGTGTAATTGTCGAGGGGAAAAACTTGGTCAAGAA
ACATATCAAACAAGGGCAAGGCCATGAAGGTGGAATATTTACAGTTGAAGCCCCGCTGCATGTATCCAATGTTCAGCTTGTAGATCCAGT
CACAGGGAAACCAACCAAGGTCGGAATTAGATACCTGGACGATGGCTCCAAAGTAAGAGTGTCGAGAGGTATAGGAGCATCAGGTTCTAT
AATTCCCCGGCCCGAGATCTTAAAAACAAGAACCACACCAAGGCCTACAGTTGCTGGTCCTAAGGATACTCCAATGGACGTTGTCATGGA
GAGGACATATGATCCAAAAACAGGAAAAGGCATGCCAGATCTCCTAAGAAAATGTGGTGCAGAAGCTAGTAATCTAATGCAATACTTTTG
TGAGAACACGGTTGTTATTTATTTCATTTTACAAACTCTTAACACTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (3)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1
Capsicum annuum	KS10	Hairy root	2179	1
Capsicum annuum	KS11	Early root	2168	1

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1734	KOW Ribosomal_L24 Ribosomal_L24_26 Ribosomal_L26e/a	11
2	26317	KOW Ribosomal_L24 Ribosomal_L24_26 Ribosomal_L26e/a	5
5	61139	KOW Ribosomal_L24 Ribosomal_L24_26 Ribosomal_L26e/a	4
1.1	102723	KOW (Kyrpides Ouzounis Woese) motif Ribosomal protein L24/L26 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L24 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Translation protein SH3-like KOW	11
2	121885	Ribosomal protein L24/L26 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KOW Translation protein SH3-like KOW (Kyrpides Ouzounis Woese) motif Ribosomal protein L24 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	6
5	132083	Ribosomal protein L24/L26 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KOW Translation protein SH3-like KOW (Kyrpides Ouzounis Woese) motif Ribosomal protein L24 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	6

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: