Sol Genomics Network

Unigene SGN-U198907

Unigene Basic Information

Unigene ID:	SGN-U198907
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	198907
mRNA sequence:	Length: 679 bp

>SGN-U198907 Capsicum annuum #1 (2 members)
TTCTCTCTCCACTTTCTCTTCTCTCTCTCTATCTTCCCCATCCCGTTTCTCTAACTTTACATCCCAACCCAATCATACATTCTTCACCTC
AAAAACCACCCACCCACCCTTCCACCTCCTCTTAAACCCAAAAAAATTCAACCCCATTAAGCTCAATTCCACACCTGCCGAAACTATTTT
CTATGACAACTCAGACCCTGAAGAAATCTCCACTTTTGACCCCCCAGAATGCCCCGAAGACTTCATTGAACCGCCCTCTTTCGACGAGGG
GACAATGGAGTCGGAAGAGGAGATTGCGAAGGCGTATGAGGAGCTTTACGGGTCTGCGTATAGTGGGGAGACGTTTCTGGGGAATGATGT
ATACGTGATGGATGCGAAAGTGAAGAAGACGAGTGGGTTTGGGAAAGCGAAGAAGGAGAAGGCGAAGGACGGGTTTGATGAGAGAGTGGT
GCAGGTTAGGAGGGTGACGAAGGTTGTGAAAGGGGGGAAGCAGCTGCATTTTAGAGCGATTGTGGTTGTGGGTGATAAGAAAGGGCAAGT
TGGTGTTGGAGTTGGGAAGGCGAAGGAGGTGATTGCTGCTGTCCAGAAGTCTGCCGTCAATGCGAGGAGGAATTTGATCACTGTGCCTAT
GACGAAGTACCTCACTTTCCCACACAGGTCGGAGGGAGATTTTGGAGCT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1
Capsicum annuum	KS09	Young fruit (0.5-2 cm)	4055	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	568	Ribosomal_S5_C Ribosomal_S5_e/a Ribosomal_S5_b/o Ribosomal_S5	32
2	26346	Ribosomal_S5_C Ribosomal_S5_e/a Ribosomal_S5_b/o Ribosomal_S5	5
5	60349	Ribosomal_S5_C Ribosomal_S5_e/a Ribosomal_S5_b/o Ribosomal_S5	5
1.1	101816	Ribosomal protein S5 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	35
2	122334	Ribosomal protein S5 bacterial and chloroplast - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) Ribosomal protein S5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	5
5	132532	Ribosomal protein S5 bacterial and chloroplast - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) Ribosomal protein S5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S5 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: