Sol Genomics Network

Unigene SGN-U203552

Unigene Basic Information

Unigene ID:	SGN-U203552
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	203552
mRNA sequence:	Length: 484 bp

>SGN-U203552 Capsicum annuum #1 (1 members)
CTCACCTCCGCCCTCGAACAAACACTTTTGGTGCGGTTTCGAGGGTGAGGAATGCTTTGGCCTATGCTACACACAAATTTTTCCAAGAAA
ATGGCTTTGTTTGGATCTCAAGTCCAATAATCACTGCTTCTGATTGTGAAGGAGCTGGCGAGCAATTCTGTGTGACTACATTGGTATGTA
ATGTTGATTTAATATGTTAAATCATCTATTTGGTCTTCCCCAAATTCCCAGTTGGTGTTCAAGCACTATGTGTGCCATCTCTCTTCACAT
TCATCACCTTTCACAAGAACTAAGAAAGGGAGGAAAAGAGAAAAAAACAGCAAAGCTCTGAACTTGGTTGAGGACTAACAGGATGCTGTA
TTGAAAGTTTGAAACTCTCCATCATGTATCTTGTTTGTCTAAATGTTGTTTAAGACTGTTCAACACAAAGCTTTAAGGCTTAATCTACGT
GTAGTCTTGTTAGTCTTGCGGAAGTGATTCTTTT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS10	Hairy root	2179	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E507088
[Show Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	337	AsnS AspS_arch tRNA-synt_lys_2 tRNA_anti tRNA-synt_2	49
2	23204	AsnS AspS_arch tRNA-synt_lys_2 tRNA_anti tRNA-synt_2	15
5	60435	GenX AsnS AspS_arch tRNA-synt_asp tRNA-synt_lys_2 tRNA_ligase_II tRNA_anti tRNA-synt_2 tRNA-synt_2d AspS_bact	5
1.1	101603	tRNA synthetase class II (D K and N) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418)	62
2	119485	tRNA synthetase class II (D K and N) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418)	15
5	132765	Aminoacyl-transfer RNA synthetase class II - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) nucleic acid binding OB-fold tRNA/helicase-type - Molecular Function: nucleic acid binding (GO:0003676) Asparaginyl-tRNA synthetase class IIb - Molecular Function: asparagine-tRNA ligase activity (GO:0004816) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: asparaginyl-tRNA aminoacylation (GO:0006421) tRNA synthetase class II (D K and N) - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Aspartyl-tRNA synthetase class IIb - Molecular Function: aspartate-tRNA ligase activity (GO:0004815) - Molecular Function: ATP binding (GO:0005524) - Biological Process: aspartyl-tRNA aminoacylation (GO:0006422) Nucleic acid-binding OB-fold - Molecular Function: nucleic acid binding (GO:0003676) Nucleic acid-binding OB-fold subgroup	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: