Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U204384

Unigene Basic Information

Unigene ID:	SGN-U204384
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	204384
mRNA sequence:	Length: 317 bp

>SGN-U204384 Capsicum annuum #1 (1 members)
GATCCCCCGGGCTGCATGGGCTAATTGGTTACTTTGAGGATCCTGAGATGGCTGACGGGGAGCTGGAAATTTCTAACCAAGAAATGTTAT
CAAGTTCGAATTTTGGTGAATTTAGTAGCTCCATGGACAGCTTTTTCAATGAGATACTCAAGGATGCGCATGCTTGTACTCATGCTCACA
CTTGTAACCCGACCGGTCCTGATAACTACCATACCCATACTTGCTACCATGTTCACACCAAAATAGTGCCTACCTCCGAAGACGATAAGA
ACCCCAGCGATGATACTGCACAGTCTGCGGAAAATAAAGGGAAGAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E492481
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	32	TF_bZIP	291
2	23314	TF_bZIP	13
5	57877	TF_bZIP	10
1.1	102782	Basic-leucine zipper (bZIP) transcription factor - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983) Eukaryotic transcription factor DNA-binding Basic leucine zipper - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355)	10
2	120154	Eukaryotic transcription factor DNA-binding Basic leucine zipper - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) Basic-leucine zipper (bZIP) transcription factor - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983)	10
5	130926	Eukaryotic transcription factor DNA-binding Basic leucine zipper - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) Basic-leucine zipper (bZIP) transcription factor - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565) - Molecular Function: protein dimerization activity (GO:0046983)	8

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: