Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U204791

Unigene Basic Information

Unigene ID:	SGN-U204791
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	204791
mRNA sequence:	Length: 429 bp

>SGN-U204791 Capsicum annuum #1 (1 members)
GTTTTTTTTTTTTTTTTTTAGAAAAGTTGATAGTATCTTTATTGAGAGATCTAATCTACAGCTGATTGGCACAAACGAACCAATTCTTCT
AGCCAAAGCAATCAAAAATACATAATGTCAGAGGCCAACACTAACAAAAAAGTGATTTCAACAGCCAGACTAGCTTGTCCGACGTGTAAG
AAAAACAAAGATACTTCACAAATATAAAACAGGTGCACTCTTTCTCTACTCTGCTCTAGATTGACCAGCGCGAGAAGAAAGGATGATACC
AACAATAAGGCCGTAAAGAGCCAAGGCTTCAGCAAAAATAAGGATCAGAATCATTCCAACAAAAAGCTTTGGCTGCTGTGCATTAGCTCT
AACACCGGCATCACCAACGATTCCAATAGCCATACCGGCAGAAAGACCAGCAAGACCACAGGCAAGACC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS01	leave	6599	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E488399
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	317	ATPase_Csub ATP_synth_C Vac_ATPsynt_Csub	51
2	22204	ATPase_Csub ATP_synth_C Vac_ATPsynt_Csub	46
5	56510	YidE_YbjL ATPase_Csub ATP_synth_C Vac_ATPsynt_Csub	35
1.1	101725	ATPase F0/V0 complex subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: membrane (GO:0016020) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase V0 complex proteolipid subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	43
2	118618	ATPase V0 complex proteolipid subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F0/V0 complex subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: membrane (GO:0016020) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	43
5	129191	ATPase V0 complex proteolipid subunit C eukaryotic - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) ATPase V0 complex proteolipid subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: integral to membrane (GO:0016021) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F0/V0 complex subunit C - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: membrane (GO:0016020) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	32

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: