Sol Genomics Network

Unigene SGN-U205649

Unigene Basic Information

Unigene ID:	SGN-U205649
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	205649
mRNA sequence:	Length: 637 bp

>SGN-U205649 Solanum melongena #2 (5 members)
TTTTTTTTTTTTTTTTTTTTAAAACGAAAATGTTGAAATTGATGGGAAGTCCAATCAACTTTTACATGATACAAGAGGTGAGAAAATTAG
TTAACAGTAACTTTGCCAACCATTCCAGCTCCTTGGTGTGGTGCACAGTAGAAAGTGTACGTTCCTTTCTCAGTCAAAGTGACAGTGTAA
GTCTCTCCTGGTGCATTCAGAAGATCCTCTTCAGGCATGGAAATCTTACTTGCATCCACACCAGCTGGGATTTCATCCTCATCGAATACG
ATGTTGTGGGGGAACCCTGCATTGTTCTTGAATATAATTTTCTCACCGGCGCTAACGCTGAAGTTTCCGGGAACAAAAGCAAGACTTCCA
TCATCACCACCAAGCAACACTTCAACAGCCAAGGCATTGCTAGCTAGCATCGCGCTAACAGCGGTGGCAGCGACGACAGCACCAACGTCT
TTCAAAGATGCCTTCACCGTCATTCTGGCAGCCGGAGAGGCTGACACCTTGGCGGAGAGGGTGCCAACTCTGGGAGATGAGGAAGCACCA
GCCTTGAGGCCAGTGAAAGATGGAATTGCAACAGCAGCAGAGGTAACAGTGGCCATTGTTAATATGTATTGATGGCTGTTGGTTGCTTTT
GTGATTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	5

mRNA member sequences (5)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1400	BlueCu_1 Plastocyanin Copper_blue	13
2	23477	BlueCu_1 Plastocyanin Copper_blue	12
5	57555	BlueCu_1 Plastocyanin Copper_blue	12
1.1	102572	Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118)	12
2	119779	Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin	12
5	130104	Plastocyanin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper protein - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper domain - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Blue (type 1) copper subtype - Molecular Function: copper ion binding (GO:0005507) - Biological Process: electron transport (GO:0006118) Cupredoxin	12

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: