Sol Genomics Network

Unigene SGN-U205678

Unigene Basic Information

Unigene ID:	SGN-U205678
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	205678
mRNA sequence:	Length: 696 bp

>SGN-U205678 Solanum melongena #2 (4 members)
GGTTGTTCAGAAGCGTTTTAATTTCAAGGAGAACAGCGTTGTGCTCTATGCAGAGAAAGTCAACAATAGGGGTCTATGTGCCATTGCTCA
GGCTGAATCACTGCGATACAAGCTACTTGGAGGACTTGCTGTCCGAAGGGCTTGCTATGGAGTTCTGAGATTCGTCATGGAGAGTGGAGC
CAAGGGATGCGAGGTGATTGTTAGTGGAAAGCTCCGTGCTCAGCGCGCCAAGTCCATGAAGTTTAAGGATGGTTACATGATTTCTTCTGG
CCAACCTGTTAAAGAATACATTGATTCAGCTGTTAGGCATGTGCTACTCAGGCAGGGTGTGCTTGGTATCAAAGTCAAGATCATGCTTGA
CTGGGATCCTAAGGGTAAACAAGGGCCTATGACACCATTGCCAGATTTGGTGACTATTCACCCACCTAAGGAGGCACAAGAGTTTGTTCC
TCCTCCTATGATAGCTGCTCCGGCAATCGAGGTTCTTCCTGTGGCATAAGGACTTGTGTTATCTCCGGTCTTGAGAACTCTTGCACTAGC
TGGCCTGTACTTTTATTTATTCTCCTTTTTCATTGCTGAATACTAGATTACGTAGTGAACCATTTTGCTTTGTAGTTTCTGTTATGCAAG
ATACTGGTAAGCATTTTTGTTAATCTTATCTCTCATCTGTTGAACTGAAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	4

mRNA member sequences (4)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	935	S3_euk_arch Ribosomal_S3_C S3_bact KH_TYPE_2 KH	20
2	22748	S3_euk_arch Ribosomal_S3_C S3_bact KH_TYPE_2 KH	20
5	56890	S3_euk_arch Ribosomal_S3_C S3_bact KH_TYPE_2 KH	20
1.1	102210	KH prokaryotic type Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	19
2	119191	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19
5	129545	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: