Sol Genomics Network

Unigene SGN-U206123

Unigene Basic Information

Unigene ID:	SGN-U206123
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	206123
mRNA sequence:	Length: 683 bp

>SGN-U206123 Solanum melongena #2 (2 members)
TTTTTTTTTTTTTTTTTTTTAGCCAAAATGAAAACAAACTAGCATAGCCAGATATACCAAATAACATAAACTCTCCAAAAATTTTCAACT
CCTCAAAGAGAAGTAAATGCTGGTCTACAAAATGCATAAAACACTTGCTGGGAGATGAACTGATCCAAAAATGGATTTTCCAACTTACTG
AATGTTTGAGGATTTGTTGAGGATGACACCTTCATATTTGACCTGGAACCACTTCATTGCGTCCTCTTTTGTGACCCTGTGCTGAATTCC
AACTCGAGACTTGCACCTACGGCGACGAGCAACACGGTATCCTGGGCGCTCTAGCACAACGTAGAAATCCATACCGTAGATACCAGTTGA
AGGGTCATACTTAATTCCAAGATCGATGTGCTCCTGGATACCAAAACCAAAGCAGCCAGTCTCACTGAAGTTTCGTCTCAACAACTCGTA
TTCCTTGACCTTCAATCCACTCTCAAGGAGCTGCATAGCTTTCTCTCCTCTCACAGTGACATAGCAAGCTATCTTCTCATTACGCCTGAT
TCCAAAGGATCGCACAGTATACCTAGCTTTGGAGAAAACAGGGGATTGACCACTTAGTTGCTCCAAGACCTTAGCTGCCCTGGTAAGTCT
ATCTCCGCTCTCACCGACGGAGATGTTGAGGACTAGCTTCTGAACCTTGATAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	2

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	520	Ribosomal_L5 Ribosomal_L5_mit	34
2	22500	Ribosomal_L5 Ribosomal_L5_mit	27
5	56684	Ribosomal_L5 Ribosomal_L5_mit	26
1.1	101834	Mitochondrial ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	34
2	118848	Ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Mitochondrial ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28
5	129265	Ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Mitochondrial ribosomal protein L5 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	28

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: