Sol Genomics Network

Unigene SGN-U207408

Unigene Basic Information

Unigene ID:	SGN-U207408
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	207408
mRNA sequence:	Length: 158 bp

>SGN-U207408 Solanum melongena #2 (1 members)
GCTGTTTTAGGTGCAGCAAAAGCTCTTGCTGAATTAAGGCCTTTTGGAGTAGAGGTGCATTTCATTGTTGCAGCTTGCGAAAATATGATC
AGTGGAGAAGGCATGAGGCCTGGAGACATTGTCACAGCTTTCAAATGGGAAGACCATTGAGGTTAACA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E519908
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	401	Peptidase_M17_C Ribosomal_L16 Ribosomal_L10E Peptidase_M17_N	43
2	22233	Peptidase_M17_C Ribosomal_L16 Ribosomal_L10E Peptidase_M17_N	42
5	56445	Peptidase_M17_C Ribosomal_L16 Ribosomal_L10E Peptidase_M17_N	42
1.1	101635	Ribosomal protein L10E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Peptidase M17 leucyl aminopeptidase C-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Lg106-like Peptidase M17 leucyl aminopeptidase N-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508)	54
2	118642	Peptidase M17 leucyl aminopeptidase C-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Peptidase M17 leucyl aminopeptidase N-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Ribosomal protein L10E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	40
5	129107	Peptidase M17 leucyl aminopeptidase C-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Peptidase M17 leucyl aminopeptidase N-terminal - Molecular Function: aminopeptidase activity (GO:0004177) - Cellular Component: intracellular (GO:0005622) - Biological Process: proteolysis (GO:0006508) Ribosomal protein L10E - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	40

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: