Sol Genomics Network

Unigene SGN-U208231

Unigene Basic Information

Unigene ID:	SGN-U208231
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	208231
mRNA sequence:	Length: 697 bp

>SGN-U208231 Petunia hybrida #1 (2 members)
CACTTGTTATCCNTCGAAAAAGTCAAGGGACCCAAGTACCAGGAGATTGTCAACATTCGTTTGGGAGATGGAACAATACGACGTGGGCAA
GTACTGGAGGTTGATGGAGAAAAAGCTGTTGTTCAGGTTTTTGAAGGAACATCTGGAATTGACAATAAATACACAACTGTGCAGTTTACT
GGAGAGGTGTTAAAAACACCAGTTTCACTGGATATGCTTGGACGTATCTTCAACGGTTCAGGGAAGCCCATTGACAATGGTCCTCCAATT
TTACCTGAGGCTTACTTAGATATTTCTGGAAGTTCTATCAACCCTAGTGAGAGAACCTATCCTGAAGAGATGATTCAAACCGGAATTTCA
ACAATCGATGTCATGAATTCAATTGCTAGAGGGCAGAAAATTCCTCTTTTCTCTGCTGCTGGTCTTCCTCATAATGAAATTGCAGCCCAG
ATCTGTCGTCAGGCTGGTCTAGTGAAGAGGTTGGAGAAATCTGACAATCTTCTTGAGGGTGGTGCTGAAGACGACAATTTTGCCATAGTC
TTTGCAGCTATGGGAGTCAACATGGAAACGGCTCAATTTTTCAAACGTGATTTTGAGGAAAATGGATCCATGGAGAGAGTGACACTTTTC
TTAAACCTGGCCAATGATCCTACAATAGAACGTATTATCACTCCTAGGATTGCTCTGACAACTGCAG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-DevA	all floral organs several	2870	1
Petunia x hybrida	Petunia-YF	whole fruit (ovary) several	947	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	202	ATPase_a/bN FliI_YscN ATP_synthF1_alph ATPase_a/bcentre ATP_synthA_B ATP_synthV_B	73
2	22829	KOW ATPase_a/bN FliI_YscN ATP_synthF1_alph ATPase_a/bcentre ATP_synthA_B ATP_synthV_B	19
5	56977	KOW ATPase_a/bN FliI_YscN ATP_synthF1_alph ATPase_a/bcentre ATP_synthA_B ATP_synthV_B	19
1.1	101561	ATPase F1/V1/A1 complex alpha/beta subunit C-terminal - Biological Process: ATP biosynthesis (GO:0006754) - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F1/V1/A1 complex alpha/beta subunit N-terminal - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F1/V1/A1 complex alpha/beta subunit nucleotide-binding - Molecular Function: ATP binding (GO:0005524) - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	73
2	119378	ATPase F1/V1/A1 complex alpha/beta subunit nucleotide-binding - Molecular Function: ATP binding (GO:0005524) - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F1/V1/A1 complex alpha/beta subunit N-terminal - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	16
5	129713	ATPase F1/V1/A1 complex alpha/beta subunit nucleotide-binding - Molecular Function: ATP binding (GO:0005524) - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961) ATPase F1/V1/A1 complex alpha/beta subunit N-terminal - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	16

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: