Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U209856

Unigene Basic Information

Unigene ID:	SGN-U209856
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	209856
mRNA sequence:	Length: 483 bp

>SGN-U209856 Petunia hybrida #1 (1 members)
CAGAAGTAGAAGCCTCTTGTTTTCGCTCGCAACAAGGAAGAATCAAGGCAATGGCGACAGAAGTAGCAGCAGCAGCCCCCGCCGTCCCCG
CAGCAGCAGCCGCAGCCGCAGCAGGAGGTGATGACAAAGTGATTCACAGCGATGTTATGCTCTTCAACCGCTGGACCTACGATGAAGTCA
CGGTCAATGACATGTCTGTGGAGGATTACATTACAGCAACTTCTGCCAAACATCCAGTTTACATGCCCCACACAGCTGGTAGGTACCAGG
CAAAACGTTTCAGAAAGGCCCAGTGCCCAATTGTTGAGAGGCTTACCAACTCTCTGATGATGCACGGACGTAACAATGGTAAGAAGTTGA
TGGCTGTTCGCATCGTTAAGCATGCCATGGAGATCATTCATTTGTTGACTGACCAGAACCCTATTCAAGTCATCGTTGATGCTGTCATTA
ACAGTGGGCCAAGAGAAGATGCAANCCGAATTG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-C2H4	all floral organs anthesis	3072	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E524363
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (3)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	949	Ribosomal_S7 Ribosomal_S7_b/o	20
2	22963	Ribosomal_S7e/a Ribosomal_S7 Ribosomal_S7_b/o	17
5	57075	Ribosomal_S7e/a Ribosomal_S7 Ribosomal_S7_b/o	17
1.1	101729	Ribosomal protein S7 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	43
2	119706	Ribosomal protein S7 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) Ribosomal protein S7 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	13
5	130296	Ribosomal protein S7 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) Ribosomal protein S7 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	11

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: