This unigene is from an out-of-date build,
Lycopersicon Combined #3
It has been superseded by SGN-U578741 in the current build, Tomato 200607 #2
It has been superseded by SGN-U578741 in the current build, Tomato 200607 #2
Unigene Basic Information |
Unigene ID: | SGN-U232334 |
Unigene Build: | Lycopersicon Combined #3 |
Date: | 2004-06-30 |
Organism: | S.lycopersicum S.habrochaites S.pennellii |
Alternative ID: | 232334 |
mRNA sequence: | Length: 191 bp |
>SGN-U232334 Lycopersicon Combined #3 (1 members)
ACAAGAGGAGGAGCTCCCCTCGGTGATTGACATCAGCCGTAAAATGGCGGTCCAGCCTGTAATTGGGCTCCGGGCTAAGCTTAGGACCAA
ACATTCCGGTCATTTTGGATCCACTTCTGGAGAGAAAGGCAAGTTTGGGCTTACAACAACTCAGATCCTTCGTGTGGTGAGGAAACTGAA
AGAATCCGGAA
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
![]() |
![]() |