This unigene is from an out-of-date build,
Lycopersicon Combined #3
It has been superseded by SGN-U585313 in the current build, Tomato 200607 #2
It has been superseded by SGN-U585313 in the current build, Tomato 200607 #2
| Unigene Basic Information |
| Unigene ID: | SGN-U233260 |
| Unigene Build: | Lycopersicon Combined #3 |
| Date: | 2004-06-30 |
| Organism: | S.lycopersicum S.habrochaites S.pennellii |
| Alternative ID: | 233260 |
| mRNA sequence: | Length: 131 bp |
>SGN-U233260 Lycopersicon Combined #3 (1 members)
AAAAGATCTCCACAAAGATGCAATGGGTCATACTAAGGAGCAATTGCTTGTCCGTTTACAGGAGCTTCAAATTGATTTCACCAAACATGA
ACACCCAGTTGTTTTGACAGTTGAAGCACAGGCAAAGCATG
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
[Show Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 1 | go: 0 )
|
Protein prediction analysis (1)
|
Gene Family (3)
|
Preceding Unigenes (1)
|
Library representation (1)
Library representation (1)

