Sol Genomics Network

Unigene SGN-U272029

Unigene Basic Information

Unigene ID:	SGN-U272029
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	272029
mRNA sequence:	Length: 471 bp

>SGN-U272029 Solanum tuberosum #4 (4 members)
CTCATGCCAGCAAACGAAAATGTCTTTCCACATGATATTGCACTCATTTCCTCAGTCAATGCTTTAATTCAAGTGAACTTTTAAAGTAAG
TCGGTCTCAGTTCCAAGAGGTGAAAGTTGCACAAACACTATATCTACCTGGAACCCTATTTTCCGTCAGTGTATCTTGTGAAGAGTTATT
ATATGAAGGGTAAAGTCTGAAGCTATATGTTATGTACTGTGTATATGTGTATGAACTGTTATGTTCATTGGCACTGTTGCAGTCTAGCTG
AGCATACGATGTGCAGGTTGATTATGTACCACTATCTGTTGTTATAACCACATTTAAGAAGGAGAGTGTAAAGCATCCTCTTGAGGGTTT
TGGAGTGCTTGTACCTTCCGAGGAGCAAAAACATGGTCTGAAGACATTAGGCACCCTCTTCTCTTCTATGATGTCTCCAGATCGTGCATC
CAACAATGTCTATCTCTATAC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
AJ225108	mitochondrial protoporphyrinogen 9 oxidase	oxidase

Genomic locations (0)

None

Library representation (3)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	2
Solanum tuberosum	STOL	Stolon	6462	1
Solanum tuberosum	cPRO	roots in vitro grown stem cuttings	10187	1

mRNA member sequences (4)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1919	Proto_IX_ox Amino_oxidase	10
2	25767	NAD_BS Proto_IX_ox Amino_oxidase Flav_cont_mnoxgn Adrndx_reductase Moxy_FAD_binding Gid	6
5	59753	NAD_BS Proto_IX_ox Amino_oxidase Flav_cont_mnoxgn Adrndx_reductase Moxy_FAD_binding Gid	6
1.1	101442	Amine oxidase - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491) NAD-binding site	155
2	121865	NAD-binding site Adrenodoxin reductase - Biological Process: electron transport (GO:0006118) Protoporphyrinogen oxidase - Molecular Function: protoporphyrinogen oxidase activity (GO:0004729) - Biological Process: electron transport (GO:0006118) - Biological Process: porphyrin biosynthesis (GO:0006779) Amine oxidase - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	6
5	132071	NAD-binding site Adrenodoxin reductase - Biological Process: electron transport (GO:0006118) Protoporphyrinogen oxidase - Molecular Function: protoporphyrinogen oxidase activity (GO:0004729) - Biological Process: electron transport (GO:0006118) - Biological Process: porphyrin biosynthesis (GO:0006779) Amine oxidase - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	6

Preceding Unigenes (1)

Unigene	Build
SGN-U246021	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: