Sol Genomics Network

Unigene SGN-U286679

Unigene Basic Information

Unigene ID:	SGN-U286679
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	286679
mRNA sequence:	Length: 697 bp

>SGN-U286679 Solanum tuberosum #4 (1 members)
CTCATTTGTATCTGCCATCGGCCGCAGTGAATCAATATCAAACCCTAATCTCAACATGGCGACGCCTCAGATTAGTAAAAAGCGAAAGTT
TGTAGCGGATGGAGTTTTTTTTGCGGAGTTGAACGAAGTGCTGACAAGAGAGTTGGCGGAGGATGGTTACTCGGGAGTTGAAGTTAGGGT
TACTCCCATGCGAACTGAAATCATCATTAGGGCTACTCGTACTCAAAACGTTCTTGGTGAAAAAGGTAGGAGGATTAGGGAGCTGACTTC
AGTTGTTCAGAAGCGTTTTAATTTCAAGGAAAATAGTGTTGAGCTCTATGCAGAGAAAGTCAACAATAGGGGTCTGTGTGCCATTGCTCA
AGCAGAGTCACTGCGATACAAGTTACTTGGAAGACTTGCTGGCCGAAAGGCTTGGTATGGGGGTCTGCGATTTGTAATGGAAAATGGAAC
CCAAGGATGCCAAGGGATTGGTAGTGGAAAGCTTCCTGCTTAACGTGCCAAGTCCATGAAGGTTAAAGGTGGGTACCTGAATTCTTCTGG
CCCACCTGGTAAAGAATACCTTGGTGCCACTGGTAAGCCTGTGCTTCTTAAGGAAGGTGGGCCTCGGTATCAAAGTAAGATCATGCTTGA
CTGGGATCCTAAGGGTAAACAAGGGCCTATGACCCCATTGCCAGATTTGGTGACTATTCATCCACCC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
DQ294256	40S ribosomal protein

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E418278
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	935	S3_euk_arch Ribosomal_S3_C S3_bact KH_TYPE_2 KH	20
2	22748	S3_euk_arch Ribosomal_S3_C S3_bact KH_TYPE_2 KH	20
5	56890	S3_euk_arch Ribosomal_S3_C S3_bact KH_TYPE_2 KH	20
1.1	102210	KH prokaryotic type Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	19
2	119191	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19
5	129545	Ribosomal protein S3 C-terminal - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Eukaryotic/archaeal ribosomal protein S3 - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935) KH type 2 - Molecular Function: nucleic acid binding (GO:0003676) KH prokaryotic type	19

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U258937	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: