Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

Unigene SGN-U287283

Unigene Basic Information

Unigene ID:	SGN-U287283
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	287283
mRNA sequence:	Length: 572 bp

>SGN-U287283 Solanum tuberosum #4 (1 members)
CTTGACTTTACCTCTGCTGCCTCTTCTTTTTTTTTTCATCCATCTTCTGCTTCTTCTCCTTTTTCCTAATCGATCTCTGCACGAATCCCA
AAAAATCCTTTTTTTTTTTTTTGAAATAGTCAGCTATGACTCTTGGTTCAGGAGGATCTAGTGTTGTGGTCCCTCGGAATTTCAGATTAC
TTGAGGAACTTGAACGCGGTGAAAAGGGTATTGGAGATGGGACTGTAAGCTATGGGATGGATGATGGAGATGATATCTATATGCGGTCCT
GGACTGGCACCATTATTGGTCCTCACAATGTTAGAGCATTCTTTTCTCTTTCCTAGTTCCAGCCATCTCTAAGTTCGATTTTAATATGGC
TTTGTTGTAGGCAAATGAAATCTTTAATATATTTTCTATTAGTTATTTGAATAATTCCCCAGGACTATTCAATTGCTTGTTTACTATGAC
TTTAACTTCTTTTCCATCCTTATTATTGGATTCTTATATCTTTAATTATTAAAGGCTAATTTTCCATGTTTCCAGTCCGTTCATGAAGGT
CGCATTTATCAGTTGAAGTTATTCTGTGATAA

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
DQ191643	ubiquitin-conjugating enzyme

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	STM	mixed tissues	14805	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E431833
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	25	UBQ_conjugat	316
2	22626	UBQ_conjugat	23
5	56769	UBQ_conjugat	23
1.1	101402	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	283
2	119235	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	18
5	129581	Ubiquitin-conjugating enzyme E2 - Molecular Function: ubiquitin-protein ligase activity (GO:0004842) - Biological Process: protein modification (GO:0006464) - Biological Process: ubiquitin cycle (GO:0006512)	18

Preceding Unigenes (1)

Unigene	Build
SGN-U259665	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: