Sol Genomics Network

Unigene SGN-U287618

Unigene Basic Information

Unigene ID:	SGN-U287618
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	287618
mRNA sequence:	Length: 624 bp

>SGN-U287618 Solanum tuberosum #4 (1 members)
CTTTCTTTCACTGGAAACGCCGCCGACGGAGAAGAGAAGAAAACGANATGAGACGAGTCTCTCTCGGAAACATGGACATCCCATGGGATA
ACATCAGTGAAAGCAGCTATTGAATTGAGGGCCAGAAGAAAGCTTACCCGAACTTTAAGCATCTAATCTCGATTTTCAGCTCATTAAGGA
TGAAGAAACTGGGAAGAAGAAGCTCAAATTGATGCTTGGTTTATTCTCGCAAGGACTACTGCTTCTATTCGTACAGCACTTAGTCATGTG
GAGAATCTGATCACTGGTGTTACTAAGGGGTACCGGTACAAGATGCGTTTTGTGTATGCTCATTTTCCGATCAATGCTTCCATTACCGGC
GGGAATAAGTCCATTGAGATCCGTAACTTTCTCGGCGAGAAAAAGGTGAGGAAAGTTGATATGCTTGACGGTGTCACTGTTGTCCGCTCA
GAGAAAGTTAAGGATGAGTTGGTTTTGGATGGAAATGACATTGAACTTGTCTCTCGGATCAGCTGCCTGATAAACCAAAATGCCATGTGA
AGAACANAGATATCCCGTAAAGTTCCTTGATGGTATCTATGTCAGCGAGAAGGGAAGAATTGCTGAGGAAAGAGTAGATAACTA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	ACDA	Tubers	5977	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E580944
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	980	Ribosomal_L6 Ribosomal_L6_2	19
2	22806	Ribosomal_L6 Ribosomal_L6_2	19
5	56953	Ribosomal_L6 Ribosomal_L6_2	19
1.1	102193	Ribosomal protein L6 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L6 signature 2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	19
2	119172	Ribosomal protein L6 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L6 signature 2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	19
5	129524	Ribosomal protein L6 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L6 signature 2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	19

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: