This unigene is from an out-of-date build, Coffea canephora #1
It has been superseded by SGN-U627463 in the current build, Coffea canephora #3
Unigene SGN-U311022

Unigene Basic Information 
Unigene ID: SGN-U311022
Unigene Build: Coffea canephora #1
Date: 2005-04-24
Organism: C.canephora
Alternative ID: 128261
mRNA sequence: Length: 154 bp

>SGN-U311022 Coffea canephora #1 (1 members)
GCTGAATTGCAAATCCCTGTAACCTTGCAACTGCTATACTTTTGTGCTATGTACAGAGCAAGAGATCCCCAACCACAACCAACATCAAGA
ACAGTATGGCCATCTTTTATTTGTGACCTTTCACAGTATAGCTCCAGCATTGCTTTCTCTGCAT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E631384
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 1 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (0)None