Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.


This unigene is from an out-of-date build, Coffea canephora #1
It has been superseded by SGN-U615825 in the current build, Coffea canephora #3
Unigene SGN-U311961

Unigene Basic Information 
Unigene ID: SGN-U311961
Unigene Build: Coffea canephora #1
Date: 2005-04-24
Organism: C.canephora
Alternative ID: 132458
mRNA sequence: Length: 289 bp

>SGN-U311961 Coffea canephora #1 (1 members)
CCCCTTCTTCTTCTTCTTCTTCTTCTTCTGCTGCTGCTGCTTATTCTGCGCCCCTCCTTTTCCCTGTCAAAAAATCCAGCATCCCAACAA
GAAACTTCCCTTCATTTCTCCACTCCGCAACATCTCACATTTCCCTCGGCGTTCCCCGAGCCGCCTCCTCATCCTCCTCCCCCTCCCCCA
TGATAGAGAATGAAACCTTATAAACCCACCGTCCCCACACCTTCCTCCGCAAATCAGATGAGGCTGCGGCCTTCTCCTCCTCCTCCTCCT
CTTCTGATTCTGCCGGCTC

[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E663811
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 0 | go: 0 )  
Protein prediction analysis (1)  
Gene Family (3)  
Preceding Unigenes (0)None