Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U583953 in the current build, Tomato 200607 #2

Unigene SGN-U333292

Unigene Basic Information

Unigene ID:	SGN-U333292
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	333292
mRNA sequence:	Length: 557 bp

>SGN-U333292 Tomato 200607 #1 (2 members)
AGAGAGAGAACGAGTTTTTACACCATTCATGCAGGCAGACAGTTCAACTTCTAGAAAGTACGGAGGAACTGGTATTGGGCTAAGCATTAG
CAAGTGTCTCGTCGAGCTGATGGGCGGTCATATAAGTTTCATTAGCCGTCCCAAGATTGGAAGTACATTTTCTTTCAGTGTTAGCTTCCT
AAGATGCGAAAAACATGCTCTTGGTGATCTGAAAAAATCTCATTCTGATGATTTGCCTACATCATTCAAAGGTCTAAATGCTATTATAGT
CGATAAAAAGCCTGTAAGAGCTGCTGTAACTGGATACCATCTGAAGAGACTTGGTATTCGGGCAGAAGTTGTCAGTAGCATCAAGAGAGC
TGCAGCCACTCTTGGGAGAAATGTTTCTGTTGTTTCCAATGAGAGGAAGCTGGACATAATTCTGGTCGAGAAGGACTTGTGGATATCTGA
AGATGTTGACCTAAATTTACACTTTCCAAACATCAATCAAAATGGACACGTGTACAAGTTACCTAAGATGATCCTTCTGGCGACTAATAT
CACCAACGCTGAACATG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLED	ovary 5 days pre-anthesis to 5 days post-anthesis	9878	1
Solanum lycopersicum	cLEX	root fruit-set stage/post-fruit loading	3142	1

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 1 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101374	Homeodomain-like	561
2	119470	CheY-like Histidine kinase A N-terminal - Molecular Function: two-component sensor activity (GO:0000155) - Biological Process: signal transduction (GO:0007165) - Cellular Component: membrane (GO:0016020) ATP-binding region ATPase-like - Molecular Function: ATP binding (GO:0005524) Histidine kinase related protein C-terminal - Biological Process: phosphorylation (GO:0016310) - Molecular Function: transferase activity transferring phosphorus-containing groups (GO:0016772) Histidine kinase - Biological Process: protein amino acid phosphorylation (GO:0006468) - Molecular Function: kinase activity (GO:0016301) Response regulator receiver - Molecular Function: two-component response regulator activity (GO:0000156) - Biological Process: two-component signal transduction system (phosphorelay) (GO:0000160) - Biological Process: regulation of transcription DNA-dependent (GO:0006355)	15
5	130393	CHASE CheY-like Histidine kinase A N-terminal - Molecular Function: two-component sensor activity (GO:0000155) - Biological Process: signal transduction (GO:0007165) - Cellular Component: membrane (GO:0016020) ATP-binding region ATPase-like - Molecular Function: ATP binding (GO:0005524) Histidine kinase related protein C-terminal - Biological Process: phosphorylation (GO:0016310) - Molecular Function: transferase activity transferring phosphorus-containing groups (GO:0016772) Histidine kinase homodimeric Histidine kinase - Biological Process: protein amino acid phosphorylation (GO:0006468) - Molecular Function: kinase activity (GO:0016301) Response regulator receiver - Molecular Function: two-component response regulator activity (GO:0000156) - Biological Process: two-component signal transduction system (phosphorelay) (GO:0000160) - Biological Process: regulation of transcription DNA-dependent (GO:0006355)	10

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U231230	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: