Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577771 in the current build, Tomato 200607 #2

Unigene SGN-U333513

Unigene Basic Information

Unigene ID:	SGN-U333513
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	333513
mRNA sequence:	Length: 210 bp

>SGN-U333513 Tomato 200607 #1 (1 members)
AGAATTGTAAAAAATGGCTAGTATTTCTGGTACAATGATTAGCACTTCTTTCCTTCCAAGAAAGCCAGCTGTGACTAGCCTCAAAGCCAT
ATCAAATGTTGGTGAAGCTTTGTTTGGTCTTAAATCTGGTAGAAATGGGAGGATTACTTGCATGGGCGGATACAAAGTGAAGCTTATTTC
ACCAGATAGACCTATTGGATGAGAATGCCC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLES	leaf 4 weeks	5243	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E286581
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101478	Lactate/malate dehydrogenase - Biological Process: tricarboxylic acid cycle intermediate metabolism (GO:0006100) - Molecular Function: oxidoreductase activity (GO:0016491)	110
2	118552	2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin [2Fe-2S] plant - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118)	56
5	129094	2Fe-2S Ferredoxin-like fold - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) 2Fe-2S ferredoxin iron-sulfur binding site - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Ferredoxin - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118) Ferredoxin [2Fe-2S] plant - Molecular Function: electron transporter activity (GO:0005489) - Molecular Function: iron ion binding (GO:0005506) - Biological Process: electron transport (GO:0006118)	42

Preceding Unigenes (1)

Unigene	Build
SGN-U232074	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: