Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U593559 in the current build, Tomato 200607 #2

Unigene SGN-U334515

Unigene Basic Information

Unigene ID:	SGN-U334515
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	334515
mRNA sequence:	Length: 442 bp

>SGN-U334515 Tomato 200607 #1 (1 members)
CAGCCTGACACCAAATTGTTTAGTGAAGCTACCAATTTCAATGAGCTTAATCAGTTAGCTGAGGAAGCAAAGAGGAGAGCTGAAATCGCT
AGGCAACGTGAGCTGCACACACTTAAAGGTCACGTGGAATCAGTGGTGAAGTTGAAGGGTCTTGACATAGAGACAATTCAGCAGTCATAC
ACTGTTTGATGTGGGAGCAAGTATGACTAGTGCTACTTAACTGGTGAGTGGGTGATAGAATGAAGACATAATGAGTGTGTGAGTTACCTC
TGGAGCGACAAGTTCATAGTAGTAACATCTTCAGCGTATAAAATATATCTAGATATTTTATACATTGTTGTGCTTTGAATTCTGGGTTCA
TCTTTTCCTGCTTTTATGTATTGACTACATTATATATATTACAATGGACCAAGAATGAATATTAAGCTATATCAGCATTCAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E368178
[Show Image]

Markers Information (0)

Expression Data (1)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101433	ATPase P-type K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter - Molecular Function: ATP binding (GO:0005524) - Biological Process: cation transport (GO:0006812) - Molecular Function: ATPase activity coupled to transmembrane movement of ions phosphorylative mechanism (GO:0015662) - Cellular Component: membrane (GO:0016020)	173
2	118560	ATPase P-type K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter - Molecular Function: ATP binding (GO:0005524) - Biological Process: cation transport (GO:0006812) - Molecular Function: ATPase activity coupled to transmembrane movement of ions phosphorylative mechanism (GO:0015662) - Cellular Component: membrane (GO:0016020) Haloacid dehalogenase-like hydrolase - Molecular Function: catalytic activity (GO:0003824) - Biological Process: metabolism (GO:0008152) Plasma-membrane proton-efflux P-type ATPase - Biological Process: proton transport (GO:0015992) - Cellular Component: integral to membrane (GO:0016021) - Molecular Function: ATPase activity (GO:0016887) E1-E2 ATPase-associated region - Molecular Function: ATP binding (GO:0005524) - Cellular Component: membrane (GO:0016020) - Molecular Function: hydrolase activity acting on acid anhydrides catalyzing transmembrane movement of substances (GO:0016820) ATPase P-type cation-transporter N-terminal - Biological Process: cation transport (GO:0006812) - Molecular Function: ATPase activity coupled to transmembrane movement of ions phosphorylative mechanism (GO:0015662) - Cellular Component: membrane (GO:0016020)	54
5	129040	ATPase P-type K/Mg/Cd/Cu/Zn/Na/Ca/Na/H-transporter - Molecular Function: ATP binding (GO:0005524) - Biological Process: cation transport (GO:0006812) - Molecular Function: ATPase activity coupled to transmembrane movement of ions phosphorylative mechanism (GO:0015662) - Cellular Component: membrane (GO:0016020) Haloacid dehalogenase-like hydrolase - Molecular Function: catalytic activity (GO:0003824) - Biological Process: metabolism (GO:0008152) Plasma-membrane proton-efflux P-type ATPase - Biological Process: proton transport (GO:0015992) - Cellular Component: integral to membrane (GO:0016021) - Molecular Function: ATPase activity (GO:0016887) E1-E2 ATPase-associated region - Molecular Function: ATP binding (GO:0005524) - Cellular Component: membrane (GO:0016020) - Molecular Function: hydrolase activity acting on acid anhydrides catalyzing transmembrane movement of substances (GO:0016820) ATPase P-type cation-transporter N-terminal - Biological Process: cation transport (GO:0006812) - Molecular Function: ATPase activity coupled to transmembrane movement of ions phosphorylative mechanism (GO:0015662) - Cellular Component: membrane (GO:0016020)	54

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U214683	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: