Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U577935 in the current build, Tomato 200607 #2

Unigene SGN-U337794

Unigene Basic Information

Unigene ID:	SGN-U337794
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	337794
mRNA sequence:	Length: 565 bp

>SGN-U337794 Tomato 200607 #1 (1 members)
CCGATAGCACAAGAAGATGAACAAGAAGGAAGTGTTTAAGCTACCTAAAGGGTTTCGAGGAAGAGCTAAAAATTGCATAAGAATAGCAAG
AGAAAGAGTTGAGAAGGCGCTTCAGTACTCATACAGAGACCGCCGCAACAAGAAGAGGGATATGCGTTCTCTCTGGATTCAACGCATCAA
TGCCGGAACTCGTCAACACGGGGTGAATTATGGCAATTTCATGCACGGGTTGATGAAGGAGAACGTACAGCTGAACAGGAAAGTCTTGTC
AGAACTGTCAATGCACGAACCATACAGCTTCAAGGCCCTCGTGGATGTCTCTCGCAGCGCTTTCCCTGGGAATAAGAAGTCCATAGTACC
TCCAAAGAAGGAAGGACTTGCTGTTGTTCTTTGAATTAGTTTCCTGTGTTGTGCTTTGTGTACTCTTCTTCTTCTTCGTTAGGCATAATT
TTGTGCTAGCATTTCTGTTAGCAAGTTTCTACCAATGGTATTGAAGTCTTCTGTTTACGACAGTGCTTTAATGGAAATTTAATTTTATGT
TACTACTCTTCCGTCCACTTTGTCT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FB	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	6270	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E711685
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	103434	Ribosomal protein L20 bacterial and organelle form - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	6
2	121422	Ribosomal protein L20 bacterial and organelle form - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	6
5	132283	Ribosomal protein L20 bacterial and organelle form - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein L20 - Molecular Function: RNA binding (GO:0003723) - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: