Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U578452 in the current build, Tomato 200607 #2

Unigene SGN-U337976

Unigene Basic Information

Unigene ID:	SGN-U337976
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	337976
mRNA sequence:	Length: 468 bp

>SGN-U337976 Tomato 200607 #1 (1 members)
ATCTCAGTCATCATCTCTCTTTCTAAAAACTTCACGTCACTCGCACTTTCTCTCTCTATAAACCTAAGGTTTTTTCTCTACCTCCATCCA
TGGATGATATTCCAAATTCAATTGATGCATAGCATGTAGTGTATTTATCATCGGAGTTTGATTTCATTCGACCTCGACCCGAATAGTTCC
GGTTTGAGGTAGGTTTTATCGTGAATGGAGCCGAATTCTTATGGCAGCGGGAAAGCTGCTGTCGGTGACGGAGTAGGAGCGCCAATGTTG
CAGACGGCGCCGGCGCCGGCGCCGATACCCAGTGCGAATGCGCCGCCGCCGTTTCTGGTGAAGACGTATGATATGGTGGATGATCCGAGT
ACGGATAAGATCGTGTCGTGGAGTCCTACGAATAATAGTTTTGTGGTTTGGGATCCTCCGGAGTTTGCTAAAGACCTACTTCCGAAGTAC
TTTAAGCATAATAACTTT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E248140
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101510	HSF/ETS DNA-binding - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) Winged helix repressor DNA-binding Heat shock factor (HSF)-type DNA-binding - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	95
2	118501	HSF/ETS DNA-binding - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) Winged helix repressor DNA-binding Heat shock factor (HSF)-type DNA-binding - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	77
5	129018	HSF/ETS DNA-binding - Molecular Function: DNA binding (GO:0003677) - Cellular Component: nucleus (GO:0005634) Winged helix repressor DNA-binding Heat shock factor (HSF)-type DNA-binding - Molecular Function: transcription factor activity (GO:0003700) - Cellular Component: nucleus (GO:0005634) - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: sequence-specific DNA binding (GO:0043565)	62

Preceding Unigenes (1)

Unigene	Build
SGN-U235211	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: