Sol Genomics Network

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U582930 in the current build, Tomato 200607 #2

Unigene SGN-U338400

Unigene Basic Information

Unigene ID:	SGN-U338400
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	338400
mRNA sequence:	Length: 373 bp

>SGN-U338400 Tomato 200607 #1 (1 members)
GGCCAAGTATATAACTAGGGACGACGACCAAAGGCTTGATCTTCGATACAATCATCACCTTGAACTAGGATATAAGGTTGAGAGGCACTT
ACATGATGGAGATTTTGCTCTCTTCAATCGGCAACCCACTCTACATAAAATGTCTATTATGGGACATAGGATTAAGATCATGCCATACTC
AACTTTCTGCTTGAATTTATCTTTCATTTCTTTCTTACAATGCTGATTTTGATGGTGACGAAATGAACATGCATGTTCCACAGTCATTTG
AAACCATAGCACAGGTGCTGGAGCTTACTGATGGTCCCTAAATGTATTGTTGCACCCCAGGCCAACTGTGATTGGTATCGGCCAGGATAC
CCTTGTTTGCTGC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	cLEF	fruit pericarp mature green	5317	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E242701
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101846	RNA polymerase Rpb1 domain 3 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350)	33
2	121784	RNA polymerase I subunit A N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 4 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase alpha subunit - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Cellular Component: nucleus (GO:0005634) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 1 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 3 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 5 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350)	6
5	132724	RNA polymerase I subunit A N-terminal - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 4 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase alpha subunit - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Cellular Component: nucleus (GO:0005634) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 1 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 3 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350) RNA polymerase Rpb1 domain 5 - Molecular Function: DNA binding (GO:0003677) - Molecular Function: DNA-directed RNA polymerase activity (GO:0003899) - Biological Process: transcription (GO:0006350)	5

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U229425	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: