Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U583805 in the current build, Tomato 200607 #2

Unigene SGN-U338464

Unigene Basic Information

Unigene ID:	SGN-U338464
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	338464
mRNA sequence:	Length: 199 bp

>SGN-U338464 Tomato 200607 #1 (1 members)
GTGATTGAATAGTACAGTACAAGTGCTATGGCTGAAACTAAGAAAATAATCAATCCAAGAGTGGAAATTGATACATCTCCGCCTTTCGAG
TCAGTTAAAGAAGCTGTCGATCATTTTGGGGGCAGTGGCCCTTGGATTCCCCATCACTTGCTCCGTTTACCACCTCCCGACAATGATTCT
GAAGTTGTAGACGTGGGGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	TUS	Rearrayed collection of L. esculentum cDNA clones	37722	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E545645
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 0 | go: 0 )

Protein prediction analysis (2)

Gene Family (2)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101367	Kinesin motor region - Molecular Function: microtubule motor activity (GO:0003777) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: microtubule associated complex (GO:0005875) - Biological Process: microtubule-based movement (GO:0007018)	846
2	128770		2

Preceding Unigenes (1)

Unigene	Build
SGN-U224938	Lycopersicon Combined #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: