Sol Genomics Network

Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

This unigene is from an out-of-date build, Tomato 200607 #1
It has been superseded by SGN-U590583 in the current build, Tomato 200607 #2

Unigene SGN-U338985

Unigene Basic Information

Unigene ID:	SGN-U338985
Unigene Build:	Tomato 200607 #1
Date:	2006-07-27
Organism:	S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides
Alternative ID:	338985
mRNA sequence:	Length: 796 bp

>SGN-U338985 Tomato 200607 #1 (1 members)
GCGGACTTCTTCCCATCACCATCTTCTTCTATTTTTCACAAGCAATTTCTTTGCTGGAACAAATTGTTCTTTGTCTCTGTGAAATTAATC
TCTCTTTGTTGTAGAAATGGCTTTGACTTTCACTTCTTCATCTGCAATTCATGGCTCTTTGTCTTCTTCATCTTCTTCTTATGAACAACC
CAAAGTATCCCAATTGGGTACCTTTCAGCCATTGGATAGGCCTCAACTATTGTCGTCAACTGTTTTGAATTCTCGGAGGCGTTCGGCAGT
GAAGCCATTGTATGCTGAACCTAAGAGGAATGATTCAATAGTTCCGTCAGCAGCTACCATCGTGGCTCCTGAGGTAGGAGAGAGTGTTGA
GGCAGAGGACTTTGAGAAATTGGCTAAGGAGCTTCAAAATGCTTCCCCTCTTGAGGTTATGGACAAAGCACTTGAGAAATTTGGAGATGA
CATTGCTATTGCTTTCAGTGGTGCTGAAGATGTTGCTTTGATAGAGTACGCACATTTAACTGTAAATGGCGCTGCCCAAACAAATGGTAC
TGCTACCGTTGCTGATATTTTTGATACCAAGGACATTGTTACCTTGAGTAAGCCTGGAGTTGAGAACCTAGTAAAATTGGAAGACCGAAG
AGAGCCTTGGCTCGTTGTTCTTTATGCACCTTGGTGCCAATTTTGCCAGGCAATGGAAGGATCCTATGTTGAATTGGCTGAGAAGTTGGC
TGGTTCTGGTGTGAAAGTAAGGAAATTCAGGGCAGATGGTGACCAAAAAGCATTTTCACAAGAAGAATTGCCGCTT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
asr	adenylyl-sulfate reductase	adenylyl-sulfate reductase

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum lycopersicum	FA	Fruit Mixture of Immature green, mature green, breaker, turning, and red ripe stages	13933	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E699779
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (3)

Family Build (I value*)	Family ID	Annotation**	# Members
1.1	101384	Thioredoxin-like fold	404
2	119803	Thioredoxin-independent 5&apos -adenylylsulfate reductase - Molecular Function: oxidoreductase activity acting on sulfur group of donors disulfide as acceptor (GO:0016671) - Biological Process: sulfate reduction APS pathway (GO:0019421) Phosphoadenosine phosphosulfate reductase - Biological Process: metabolism (GO:0008152) - Molecular Function: transferase activity (GO:0016740) Thioredoxin fold Thioredoxin-related - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Thioredoxin domain 2 - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Thioredoxin domain Thioredoxin-like fold	12
5	130126	Thioredoxin-independent 5&apos -adenylylsulfate reductase - Molecular Function: oxidoreductase activity acting on sulfur group of donors disulfide as acceptor (GO:0016671) - Biological Process: sulfate reduction APS pathway (GO:0019421) Phosphoadenosine phosphosulfate reductase - Biological Process: metabolism (GO:0008152) - Molecular Function: transferase activity (GO:0016740) Thioredoxin fold Thioredoxin-related - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Thioredoxin domain 2 - Molecular Function: electron transporter activity (GO:0005489) - Biological Process: electron transport (GO:0006118) Thioredoxin domain Thioredoxin-like fold	12

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: