This unigene is from an out-of-date build,
Coffea canephora #2
It has been superseded by SGN-U618540 in the current build, Coffea canephora #3
It has been superseded by SGN-U618540 in the current build, Coffea canephora #3
| Unigene Basic Information |
| Unigene ID: | SGN-U357615 |
| Unigene Build: | Coffea canephora #2 |
| Date: | 2007-05-18 |
| Organism: | C.canephora |
| Alternative ID: | 357615 |
| mRNA sequence: | Length: 104 bp |
>SGN-U357615 Coffea canephora #2 (1 members)
GTTCCGGGAGCCGGAGGTGATGAAACAATATGGAGTCAAGACCGATATTGAAGTTCTTGACATGCTTGACACTGCTGCCCGGCAGAAAGA
GATAATCATCGTCT
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
[Show Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 2 | go: 0 )
|
Protein prediction analysis (2)
|
| Gene Family (0) |
Preceding Unigenes (1)
|
Library representation (1)
Library representation (1)

