Motifs Finder Tool


   

Upload Sequence file:

           


     

Usage:
1. Paste a sequence like in the example:
  >gene_name
  ATGGATCAGTCGGTGTTGGCGATCT  
  ACAGCTTGGCCAACTCCAGAAATTG  

  Or Upload a sequence file. It must be in FASTA format.
2. Enter motif width(s), a width for each motif must be entered. For multiple motifs, the widths are separated by commas; (16,20,...)
3. Enter expected sites, expected number of sites in each motif must be entered. For multiple motifs, the sites are separated by commas; (7,12,...)