Solanum lycopersicum intron intron:Solyc02g083520.2.1.2

Intron details  
Name Type Organism
Location(s)
SL2.50ch02:46888631..46888733
GFF source
ITAG_eugene
From BOGAS
1
Related features  
Features this intron is a part of 
TypeNameLocationLengthStrandPhase
mRNASolyc02g083520.2.1SL2.50ch02:46887881..46888805693+n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>intron:Solyc02g083520.2.1.2 SL2.50ch02:46888631..46888733

GTTCTCTTATCTTTCTTTATTTCTGTCACTTTTAAAATTCAGTTTATAAAAAAAATGGATATAACTGATTCATAATAAATTGGTGTTTTCTTAATTTGTACAG
Download sequence region Get flanking sequences on SL2.50ch02
Related viewsNone found
http%3A%2F%2Fsolgenomics.net%3A8080%2Ffeature%2F17734838%2Fdetails feature 17734838
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)