Notice: Due to overuse of the align viewer tool, the website was unreachable for a period of time earlier today. We have deactivated the align viewer and tree browser due to this abuse.

Solanum lycopersicum intron intron:Solyc04g015450.2.1.21

Intron details  
Name Type Organism
Location(s)
SL2.50ch04:5643985..5644143
GFF source
ITAG_eugene
From BOGAS
1
Related features  
Features this intron is a part of 
TypeNameLocationLengthStrandPhase
mRNASolyc04g015450.2.1SL2.50ch04:5642257..56581092,444-n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>intron:Solyc04g015450.2.1.21 SL2.50ch04:5644143..5643985 (sequence from reverse strand)

GTAAGATTACAAGATTATATTAACAGTATGATATACATATTGAAATCACTTACAAGAATTTTCATTCTGCTGCTCATGATAATCTAGAATTTATGATGTTCACATTGACATGTGTATGATCTCTTAGTTTTTTTTTACATTCCATCTTCGTTCATGTAG
Download sequence region Get flanking sequences on SL2.50ch04
Related viewsNone found
http%3A%2F%2Fsolgenomics.net%3A8080%2Ffeature%2F17789868%2Fdetails feature 17789868
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)