Solanum lycopersicum exon exon:Solyc04g015450.2.1.5
Exon details
|
| Name | Type |
Length
66
|
Organism |
|
Location(s)
SL2.50ch04:5653926..5653991
|
|
GFF source
ITAG_eugene
|
Related features
|
| Features this exon is a part of |
| Type | Name | Location | Length | Strand | Phase |
|---|---|---|---|---|---|
| mRNA | Solyc04g015450.2.1 | SL2.50ch04:5642257..5658109 | 2,444 | - | n/a |
Add items to a list:
Region sequence(s)
| reference sequence underlying each location of this feature |
>exon:Solyc04g015450.2.1.5 SL2.50ch04:5653991..5653926 (sequence from reverse strand)
GGAGTAGAGGCGCAAACCCTGGCTAATGTGTATTTAGCATTGGAAAACAATCTTGAGATCATCCCG
GGAGTAGAGGCGCAAACCCTGGCTAATGTGTATTTAGCATTGGAAAACAATCTTGAGATCATCCCG
| Download sequence region |
Get flanking sequences on SL2.50ch04
|
| Related views |
| User comments |
Please wait, checking for comments. (If comments do not show up, access them here)
Exon details
Exon details

