Notice: Due to overuse of the align viewer tool, the website was unreachable for a period of time earlier today. We have deactivated the align viewer and tree browser due to this abuse.

Solanum lycopersicum exon exon:Solyc04g072310.2.1.2

Exon details  
Name Type Length
332
Organism
Location(s)
SL2.50ch04:59341881..59342212
GFF source
ITAG_eugene
From BOGAS
1
Related features  
Features this exon is a part of 
TypeNameLocationLengthStrandPhase
mRNASolyc04g072310.2.1SL2.50ch04:59341881..59344118883-n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>exon:Solyc04g072310.2.1.2 SL2.50ch04:59342212..59341881 (sequence from reverse strand)

ATATTAGCAACAGATAGGAGGGGAAGACCACCATCAAGACCTAAAGTTGGTAGTGGACCTCCTCCTCAGAACAATTAATTGATTAGTTAGACTATATATCGAACACTTTAATTTAGTCGATGGTTATTTTGATCAGTAAATTATTTAGAATATTAAAAAGATGATCGAAATTGTTTATTTTCAAGCCACGGCACTCGATAGACCTATATAGTCGTAGTAGTCGGCCCAAAATATGTCTGCTTTTTCATATGGTCGATATTTATATCGAGACTTAGGTCTAGTCGTATTGCTCTTTTATCTTGGTTTGATTTCGGAGTTAAATTGTATTAGGT
Download sequence region Get flanking sequences on SL2.50ch04
Related viewsNone found
http%3A%2F%2Fsolgenomics.net%3A8080%2Ffeature%2F17801803%2Fdetails feature 17801803
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)