Solanum lycopersicum exon exon:Solyc05g024260.2.1.3

Exon details  
Name Type Length
211
Organism
Location(s)
SL2.50ch05:30963985..30964195
GFF source
ITAG_eugene
From BOGAS
1
Related features  
Features this exon is a part of 
TypeNameLocationLengthStrandPhase
mRNASolyc05g024260.2.1SL2.50ch05:30963570..309660331,111+n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>exon:Solyc05g024260.2.1.3 SL2.50ch05:30963985..30964195

GCCAGCATTCAGACGAATTTGCAAAGAAAAATCAACGATGGGTTATCAATCAGTACCTTACGTGGTAGCACTATTTTCATCGATGTTATGGATGTATTATGCATTTATCAAGAAAAATGCAATTCTTCTAGTCTCCATCAATTCCTTTGGTTGCATTGTTGAGACCATTTACATTACGATTTTCATTCTCTACGCATCCAAGGAGGCTAGG
Download sequence region Get flanking sequences on SL2.50ch05
Related viewsNone found
http%3A%2F%2Fsolgenomics.net%3A8080%2Ffeature%2F17824845%2Fdetails feature 17824845
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)