Solanum lycopersicum exon exon:Solyc12g099830.1.1.3

Exon details  
Name Type Length
136
Organism
Location(s)
SL2.50ch12:66818612..66818747
GFF source
ITAG_eugene
From BOGAS
1
Related features  
Features this exon is a part of 
TypeNameLocationLengthStrandPhase
mRNASolyc12g099830.1.1SL2.50ch12:66814376..668195781,461-n/a
Add items to a list:

Region sequence(s) reference sequence underlying each location of this feature 
>exon:Solyc12g099830.1.1.3 SL2.50ch12:66818747..66818612 (sequence from reverse strand)

GAAGAAGCAAGGGCTGTTGGTCAACTCCGCAACAATAGGTTAGCAAATCTTCTTGGCTGTTGTTGTGAGGGTGATGAGAGGTTGCTAGTTGCAGAATTCATGCCCAAAGAGACGCTTGCAAAACATCTTTTTCATT
Download sequence region Get flanking sequences on SL2.50ch12
Related viewsNone found
http%3A%2F%2Fsolgenomics.net%3A8080%2Ffeature%2F18014928%2Fdetails feature 18014928
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)