Sol Genomics Network

clone(s) in cart (order)

Old browser version detected

This site is optimized for modern web browsers

Please upgrade your browser

Sorry!, some features may not work in outdated browsers

Sol Genomics Network

Search
- Organisms
- Loci & Genes
- Genome features
- Expression
- Accessions and Plots
- QTLs
- Markers
- BACs
- Unigenes
- ESTs and libraries
- Gene Families
- Insitu database
- Images
- People
- FAQ
Maps
- All Maps
- The New Comparative Viewer
- Comparative Viewer
- Submit a map
- Tomato
- Tomato-EXPEN 2000
- Tomato-Kazusa/SolCAP
- Tomato QTLs
- Tomato physical map
- Tomato FPC contig map
- Tomato IL map
- Tomato FISH map
- Tomato AGP map
- Pepper
- Pepper COSII map
- Pepper-AC99
- Pepper-FA03
- Eggplant
- Eggplant COSII map
- Eggplant-LXM 2002
- More Maps
- Potato-TXB 1992
- Tobacco SSR 2007
- Arabidopsis COSII
Genomes
- Sequenced Accessions
- Completed Genomes
- Tomato
- Potato
- Pepper
- Eggplant
- Solanum pennellii
- Solanum lycopersicoides
- Solanum pimpinellifolium
- Solanum lycopersicum var. cerasiforme
- Iochroma cyaneum
- Draft Genomes
- Nicotiana attenuata
- Nicotiana benthamiana
- Nicotiana tabacum
- Petunia axillaris
- Petunia inflata
- Solanum chilense
- Coffea humblotiana
- Resequencing projects
- Solanum lycopersicum inbreds
- 150 Tomato Genome Resequencing Project
- BGI Tomato 360 genomes
- Varitome Project
Projects
Tools
- Sequence Analysis
- BLAST
- VIGS Tool
- Alignment Analyzer
- Tree Browser
- Motif Finder
- Mapping
- Genome Browser (Jbrowse)
- SolBrowse Comparative genome viewer
- Comparative Map Viewer
- CAPS Designer
- solQTL: QTL Mapping
- Molecular Biology
- In Silico PCR
- Tomato Expression Atlas (TEA)
- Tomato Expression Database (TED)
- Systems Biology
- SolCyc Biochemical Pathways
- Coffee Interactomic Data
- SGN Ontology Browser
- Breeder Tools
- Breeders Toolbox
- Bulk Query
- FTP Site
- Download Genome Sequences
- Download Gene Sequences
- Clones, Arrays, Unigenes and BACs
- Unigene Converter
About
- About
- Contact
- Cite SGN
- Links
- Help
- FAQ
- Become SGN Editor
- Forum
- FTP data
- SlideShare
- Twitter
- Facebook

Advanced

Notice: Due to overuse of the align viewer tool, the website was unreachable for a period of time earlier today. We have deactivated the align viewer and tree browser due to this abuse.

This site uses cookies to provide logins and other features. Please accept the use of cookies by clicking Accept.

Arabidopsis thaliana exon exon-auto18188231

Exon details

Name

exon-auto18188231

Type

Exon

Length

130

Organism

Arabidopsis thaliana

Location(s)

TAIR10ch02:19376532..19376661

GFF source

TAIR10

Related features

Features this exon is a part of

Type	Name	Location	Length	Strand	Phase
mRNA	AT2G47190.1	TAIR10ch02:19376202..19377531	1,138	+	n/a

Add items to a list:

Region sequence(s)

reference sequence underlying each location of this feature

>exon-auto18188231 TAIR10ch02:19376532..19376661

GGCTAAAGCGAACTGGTAAGAGTTGTAGATTAAGATGGCTTAATTACTTACGTCCAGATGTTAGAAGAGGCAACATCACTCTCGAAGAACAATTTATGATCCTCAAACTCCATTCTCTTTGGGGCAATAG

Download sequence region

Download sequence (130b)

Get flanking sequences on TAIR10ch02

Related views

None found

http%3A%2F%2Fsolgenomics.net%3A8080%2Ffeature%2F18188231%2Fdetails feature 18188231

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Your Lists

Public Lists

List Contents

List Validation Report: Failed

Elements not found:

Optional: Add Missing Accessions to A List

Mismatched case

Click the Adjust Case button to align the case in the list with what is in the database.

Multiple mismatched case

Items listed here have mulitple case mismatches and must be fixed manually. If accessions need to be merged, contact the database directly.

List elements matching a synonym

Multiple synonym matches

Multiple synonym matches have to be resolved manually. Contact database administrators if necessary.

Fuzzy Search Results

Synonym Search Results

Create a New List from Unique Names:

Available Seedlots

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Create a New List from Selected Seedlots:

Manage Seedlots

Your Datasets

Public Datasets

Dataset Contents

Dataset Validation Failed

Elements not found:

Your Calendar

Having trouble viewing events on the calendar?
Are you associated with the breeding program you are interested in viewing?

Calendar Permissions

Add New Event

Project:

Event Type:

Start:

End:

Description:

Web URL:

http://www.

Event Info

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

Edit Event

Project:

Event Type:

Start:

End:

Description:

Web URL:

Login

Show Password

Forgot Username

If you've forgotten your username, enter your email address below. An email will be sent with any account username(s) associated with your email address.

Email Address

Reset Password

To reset your password, please enter your email address. A link will be sent to that address with a link that will enable you to reset your password.

Email Address

Create New User

Notice

Before creating a new account, please check if you already have an account using the directory search.
A link will be emailed to you. Please click on it to activate the account.
All fields are required.

First Name:

Last Name:

Organization:

Username:

Username must be at least 7 characters long.

Password:

Password must be at least 7 characters long and different from your username.

Confirm Password:

Password must be at least 7 characters long and different from your username.

Email Address:

An email will be sent to this address requiring you to confirm its receipt to activate your account.