Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0101B16_SP6_56526

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0101B16_SP6_56526
Primer
SP6
ID from Seq. Facility
LE_HBa_101_B16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
179 trimmed for vector and quality, 848 raw
Sequence
>LE_HBa0101B16_SP6_56526 (raw untrimmed)
ATATTATTTGTTTTGGGGGGCAAGCATTCTTAGTTGATGTTTGATGAAATATTATTTGTTACTCAGCCACACGGTAAAGCTTTTACTAATGGGGCATTTC
TTGGTGTTAATTCAGACAGAATTGGTAGTCATAGAGTCTTCCCTATTGGCAAACTACAGTATGTTCCTTCTTCATCTTCATAGTTATTTTCTCCGTCTGG
TTTTAATTTTTGAATTTTTGTTTATGAATCTAAGGATTCTTTGATGATAATGGCGTTTTATGTTTTAACTTCATTATAGGTGTTTTAACTAATGTTGAGA
TTGTTTGTTCTTATGTAAAAATTGCATTTTTGTTGAAAAATTGTTTTTTTGTTGGAAAGATTGCTTTTTATTGAAAAAATTGTTTTTTTGTTGAAAAAAA
TCCATTTTGGGTTCCTTGATTTCAGGTAAGGTTTTACTAAGAATTTTTTATTTGTTAAAGCTTAATTAGGTTGGAAAAAAAATGGTTTTACTTACAAAAT
CTTTCCAGTTTCAATTATTCCCCGCTTTAGCACAAATTTTAAAACTTTTTTTAATAAATTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
>LE_HBa0101B16_SP6_56526 (trimmed for quality and cloning vector)
CTTTTACTAATGGGGCATTTCTTGGTGTTAATTCAGACAGAATTGGTAGTCATAGAGTCTTCCCTATTGGCAAACTACAGTATGTTCCTTCTTCATCTTC
ATAGTTATTTTCTCCGTCTGGTTTTAATTTTTGAATTTTTGTTTATGAATCTAAGGATTCTTTGATGATAATGGCGTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.917392
Expected error %
0.136337
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0101B16
Clone
Clone name
hba-101b16
LE_HBa0101B16
P101B16
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found