SGN Marker TG14

SGN-M145

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG14 image not available
Forward sequence
GAATCAAGTTCTTTGAACCCGAGGTGGCCAACTGATTGCCTATCCTTGGAGTCATATTGTACTGTTTCCTTTCCAATTTTATAAGCCAAC
TTTGGTGTTGGGGCACCAGTTCACTAAGCATCCTTGTTTACCTGGCAGAACAGATTAAAGGTGATTCACCTGAAATGGTGGAGTACGTTG
GAATGAAGAATTTAATAAATGCTGTTAAAAAAAATCTTGGCATTCGCACAGGAAAACTACTATTTGGATATGAAGGTATGCTATTGTAGA
ATGAAGAATCCATTGTTGAAGTGTTAAATTTGGCTCTTAAAATCAGATACCAACATTAGAACAAATTGGAAAATGAGGTTGTTTAGTTTC
GTATATAGATTGACTTTGTTCGGTACTTCCATGCAGGTAATTCATTTAAAGAACTTCCTTGGGGTGCTTTGGATGATGTTGTGATGGGTG
GAGTGAGTCAAAGTACATTCCAGATAGATCTAACTGGTGGGGAGAA
Reverse sequence
TAGTACAAAACCGAAAAATCAAGGAAGAATGCTGCACCAGTTCAAGTTTATATACAAACCAAAAAAAAAAAAAAGAAATAAGGAAGAAAA
ACTCACTGCTTCAAGTTTAAACTAACAATATAAAAGTGGGATCTAGATTCAAACCTGGGAGTTATGGGATCTTTAAGATACGCTCGAATG
CATGATACAGGAAGTTCAAAAGGACCTTCTTTGAATGTTGGATTCAGTTTACCATCAGATTCGAATTTGCTGAACATAAGCTGCAAATTT
ACAGGAAAAAATAAGTAAAAATGCAGAAAGCTGGGAAAGAGTGTGCAAAGATGAACAAAGGTAAGCTGCTGACATAAAATACCTGTAATG
ATGTGATTTGACTGGGGTCAAAAGGTGATGCATCTAGTACGGTTCGTGCACGGAATATAGGCCTCAAAGAAGAAAAGGGCAAACGGACCT
GGAAATGATGCACTTAGGATAAAATTTAGATTTGAGGAAAATA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1495742.2e-40111 (22.4% of RFLP seq)+
SGN-U1495752.3e-46117 (23.6% of RFLP seq)+
SGN-U1495759.9e-52102 (20.6% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53853)
Chromosome
2
Position
36.10 cM
Confidence
uncalculated
Protocol
RFLP

Dry_matter_weight_dmw2_1 Titratable_acidity_ta2_1 Eugenol_content_eug2_1 Fruit_weight_fw2_1Soluble_solid_content_ssc2_1 Sugar_content_suc2_1 3_Methylthio_propanal_content_mta2_1 Hex_3_en_1_ol_content__x3o2_1 Fruit_diameter_fd2_1 Color_a_a2_1 Dry_matter_weight_dmw2_2 Sugar_content_suc2_2 Soluble_solid_content_ssc2_2 Color_L_L2_1 Fruit_weight_fw2_2Titratable_acidity_ta2_2 Dry_matter_weight_dmw2_3 Color_b_b2_1Fruit_diameter_fd2_2 Elasticity_ela2_1 Carotene_content_car2_1 2_Isobutylthiazole_content_ibt2_1
Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53179)
Chromosome
2
Position
70.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43833)
Chromosome
2
Position
2.20 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43583)
Chromosome
2
Position
36.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43293)
Chromosome
2
Position
48.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42404)
Chromosome
2
Position
26.40 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40818)
Chromosome
2
Position
44.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39904)
Chromosome
2
Position
54.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8299)
Chromosome
2
Position
19.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8298)
Chromosome
2
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8303)
Chromosome
2
Position
12.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8302)
Chromosome
2
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG14 was used as an overgo probe on plate 16 [well D11]

Plausible BAC Matches:   P077P07

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCTTTGAACCCGAGGTGGCCAACT
B sequence
CCAAGGATAGGCAATCAGTTGGCC
AB sequence
TCTTTGAACCCGAGGTGGCCAACTGATTGC
Marker sequence
GAATCAAGTTCTTTGAACCCGAGGTGGCCAACTGATTGCCTATCCTTGGA
GTCATATTGTACTGTTTCCTTTCCAATTTTATAAGCCAACTTTGGTGTTG
GGGCACCAGTTCACTAAGCATCCTTGTTTACCTGGCAGAACAGATTAAAG
GTGATTCACCTGAAATGGTGGAGTACGTTGGAATGAAGAATTTAATAAAT
GCTGTTAAAAAAAATCTTGGCATTCGCACAGGAAAACTACTATTTGGATA
TGAAGGTATGCTATTGTAGAATGAAGAATCCATTGTTGAAGTGTTAAATT
TGGCTCTTAAAATCAGATACCAACATTAGAACAAATTGGAAAATGAGGTT
GTTTAGTTTCGTATATAGATTGACTTTGTTCGGTACTTCCATGCAGGTAA
TTCATTTAAAGAACTTCCTTGGGGTGCTTTGGATGATGTTGTGATGGGTG
GAGTGAGTCAAAGTACATTCCAGATAGATCTAACTGGTGGGGAGAA
Genomic location of TG14  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D145 marker 145
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)