SGN Marker CT62

SGN-M90

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT62 image not available
Forward sequence
AAATTACGGGAAATCGGGTTCTTCTATGAATAGGTTTGATTTTGATCTGGGTATGAACTCTGGTCGATCTCGATCTCTCAATGATCAGAA
GAATAAAACTTCGTCGTATTCTTCTTCATCATCATCCTATACGTATTCATCGACGCAATCGAAACCAAATTCTGGGTCTTCATGGACTCA
ACCTAACAAATCATCATGGACTCACCAGCCAGTAGGGTCGTTATCTGGAC
Reverse sequence
GTCCAGATAACGACCCTACTGGCTGGTGAGTCCATGATGATTTGTTAGGTTGAGTCCATGAAGACCCAGAATTTGGTTTCGATTGCGTCG
ATGAATACGTATAGGATGATGATGAAGAAGAATACGACGAAGTTTTATTCTTCTGATCATTGAGAGATCGAGATCGACCAGAGTTCATAC
CCAGATCAAAATCAAACCTATTCATAGAAGAACCCGATTTCCCGTAATTT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49345)
Chromosome
1
Position
65.38 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47281)
Chromosome
1
Position
34.61 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43655)
Chromosome
1
Position
24.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43055)
Chromosome
1
Position
31.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42355)
Chromosome
1
Position
58.90 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39062)
Chromosome
1
Position
32.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8047)
Chromosome
1
Position
32.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8049)
Chromosome
1
Position
66.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8048)
Chromosome
1
Position
24.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT62 was used as an overgo probe on plate 14 [well D7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGGGTATGAACTCTGGTCGATCT
B sequence
GATCATTGAGAGATCGAGATCGAC
AB sequence
CTGGGTATGAACTCTGGTCGATCTCGATCT
Marker sequence
AAATTACGGGAAATCGGGTTCTTCTATGAATAGGTTTGATTTTGATCTGG
GTATGAACTCTGGTCGATCTCGATCTCTCAATGATCAGAAGAATAAAACT
TCGTCGTATTCTTCTTCATCATCATCCTATACGTATTCATCGACGCAATC
GAAACCAAATTCTGGGTCTTCATGGACTCAACCTAACAAATCATCATGGA
CTCACCAGCCAGTAGGGTCGTTATCTGGAC
Genomic location of CT62  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D90 marker 90
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)