EST details — SGN-C178439

Search information 
Request: 178439Match: SGN-C178439
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C178439Clone name: TUS-29-C13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C178439 is on microarray TOM1 spot ID 1-1-4.3.4.17 [Order] [Tomato Microarray Database]
See unigene SGN-U583757 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C72066 [cLER-1-B10] Trace: SGN-T92180 EST: SGN-E280626 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E370481Length: 119 bp (883 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E370481 [] (trimmed) TTTTGCTGCAGCGGCGAAAATGGCGAACCCGGAGGAGGCTGTGGATTTCGAGCCAGAGGAAGACGATCTGATGGACGAAGACGAAGAAACATCAT
AAACTAATGCACTGATGCCAAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E370481] SGN-U583757 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T183822 [Download][View] Facility Assigned ID: FA0AAD17AB07RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.860 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5