EST details — SGN-C178439
| Search information |
| Request: 178439 | Match: SGN-C178439 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C178439 | Clone name: TUS-29-C13 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: SGN-C178439 is on microarray TOM1 spot ID 1-1-4.3.4.17 [Order] [Tomato Microarray Database]
See unigene SGN-U583757 for alternative clones/ESTs which are mapped
| Additional sequencing |
| Clone: SGN-C72066 [cLER-1-B10] | Trace: SGN-T92180 | EST: SGN-E280626 | Direction: 5' | Facility: TIGR |
| Sequence |
| Sequence Id: SGN-E370481 | Length: 119 bp (883 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E370481 [] (trimmed)
TTTTGCTGCAGCGGCGAAAATGGCGAACCCGGAGGAGGCTGTGGATTTCGAGCCAGAGGAAGACGATCTGATGGACGAAGACGAAGAAACATCAT
AAACTAATGCACTGATGCCAAAGC
AAACTAATGCACTGATGCCAAAGC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E370481] | SGN-U583757 | Tomato 200607 | Build 2 | 30 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T183822 [Download][View] | Facility Assigned ID: FA0AAD17AB07RM1 |
| Submitter: Koni | Sequencing Facility: INRA |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.860 | Expected Error Rate: 0.0053 | Quality Trim Threshold: 14.5 |


