This unigene is from an out-of-date build,
Solanum tuberosum #3
It has been superseded by SGN-U291263 in the current build, Solanum tuberosum #4
It has been superseded by SGN-U291263 in the current build, Solanum tuberosum #4
| Unigene Basic Information |
| Unigene ID: | SGN-U262215 |
| Unigene Build: | Solanum tuberosum #3 |
| Date: | 2004-07-27 |
| Organism: | S.tuberosum |
| Alternative ID: | 262215 |
| mRNA sequence: | Length: 421 bp |
>SGN-U262215 Solanum tuberosum #3 (1 members)
GGAAGGTGAGAAGTTGTTTTTCGGGATATATCATTGTTATGTGATGTATTAGTTAGAGAAGTGAGTCATTTGACAGGCTATGATCGTGTT
ATGGTTTATAAATTCCACGAGGATGAACACGGGGAAGTAGTTGCTGAATGTCGTATGCCTGAACTAGAACCTTATCTTGGCTTGCATTAC
CCTGCTACAGATATACCACAAGCTTCAAGATTTCTCTTCATGAAGAATAAGGTTAGGATGATATGTGATTGCTTAGCTCCACCAATTAGG
GTGATTCAAGACCCAAGATTGGCTCAGTCGTTGAGCCTTGGTGGATCCACATTAAGAGCTCCCCATGGCTGTCATGCACAATACATGACC
AATATGGGTACTGTTGCATCTATGGCGATGTCTGTGATGATTAGTGAGCAAGATGATGAGT
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 1 | go: 0 )
|
Protein prediction analysis (1)
|
| Gene Family (0) |
Preceding Unigenes (1)
|
Library representation (1)
Library representation (1)

