Sol Genomics Network

Unigene SGN-U297909

Unigene Basic Information

Unigene ID:	SGN-U297909
Unigene Build:	Solanum tuberosum #4
Date:	2005-05-04
Organism:	S.tuberosum
Alternative ID:	297909
mRNA sequence:	Length: 625 bp

>SGN-U297909 Solanum tuberosum #4 (1 members)
CACACCAACTGAAGCTCAGATAAAGGACATTGTGGAGTGGTTATTGGCTTACCATGGAGACTCAACAGGTTTAAGTACTGACAGTTTGGC
TGATGCTGGGTATCCTGGAGCAGCTTCACTTGGTGATGCAGTTTGTGGTATGGCTGTCGCTTATATAACTTCTAAAGATTTCTTGTTTTG
GTTTCGCTCCCACACAGCGAAAGAAATAAAGTGGGGTGGTGCAAAGCATCATCCTGAAGACAAGGATGACGGACAGAGAATGCATCCACG
TTCTTCCTTCAAGGCATTTCTGGAAGTTGTTAAAAGTCGGAGCTCGCCATGGGAAAATGCTGAAATGGATGCAATCCACTCTTTGCAGCT
AATTCTGCGAGATTCATTTAAGGATGCTGAGGCAAGTAATTCTAAGGCTATTGTGCATGCTCATCTTGGGGAAATGGAGTTGCAAGGGAT
AGATGAACTGAGTTCTGTTGCCAGAGAAATGGTTAGATTGATCGAAACTGCAACAGCTCCCATATTTGCTGTTGATGTCGAAGGTCGCAT
AAATGGTTGGAATGCAAAGGTCGCTGAATTGACAGGTTTATCAGTTGAAGAAGCAATGGGGAAGTCCTTGGTTCATGATCTTGTG

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
phyB	phytochrome B	phytochrome

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum tuberosum	cSTB	leaves and petioles 8 weeks old plants	10327	1

mRNA member sequences (1)

To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 3 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	26	Myb_SHAQKYF	311
2	22438	GAF His_kinase Phytochrome His_kinA_N PAS_domain ATPbind_ATPase	29
5	56753	GAF His_kinase Phytochrome His_kinA_N PAS_domain ATPbind_ATPase	24
1.1	101374	Homeodomain-like	561
2	118742	PAS fold Phytochrome chromophore binding site GAF PAS - Molecular Function: signal transducer activity (GO:0004871) - Biological Process: signal transduction (GO:0007165) ATP-binding region ATPase-like - Molecular Function: ATP binding (GO:0005524) PAS fold-2 Phytochrome central region Histidine kinase - Biological Process: protein amino acid phosphorylation (GO:0006468) - Molecular Function: kinase activity (GO:0016301) Phytochrome - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: G-protein coupled photoreceptor activity (GO:0008020) Phytochrome A/B/C/D/E - Biological Process: red far-red light phototransduction (GO:0009585) - Molecular Function: photoreceptor activity (GO:0009881) - Biological Process: protein-tetrapyrrole linkage (GO:0017006) - Molecular Function: protein homodimerization activity (GO:0042803) - Biological Process: regulation of transcription (GO:0045449)	32
5	129213	PAS fold Phytochrome chromophore binding site GAF PAS - Molecular Function: signal transducer activity (GO:0004871) - Biological Process: signal transduction (GO:0007165) ATP-binding region ATPase-like - Molecular Function: ATP binding (GO:0005524) PAS fold-2 Phytochrome central region Histidine kinase - Biological Process: protein amino acid phosphorylation (GO:0006468) - Molecular Function: kinase activity (GO:0016301) Phytochrome - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Molecular Function: G-protein coupled photoreceptor activity (GO:0008020) Phytochrome A/B/C/D/E - Biological Process: red far-red light phototransduction (GO:0009585) - Molecular Function: photoreceptor activity (GO:0009881) - Biological Process: protein-tetrapyrrole linkage (GO:0017006) - Molecular Function: protein homodimerization activity (GO:0042803) - Biological Process: regulation of transcription (GO:0045449)	30

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (1)

Unigene	Build
SGN-U267426	Solanum tuberosum #3

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: