This unigene is from an out-of-date build,
Tomato 200607 #1
It has been superseded by SGN-U593019 in the current build, Tomato 200607 #2
It has been superseded by SGN-U593019 in the current build, Tomato 200607 #2
| Unigene Basic Information |
| Unigene ID: | SGN-U346531 |
| Unigene Build: | Tomato 200607 #1 |
| Date: | 2006-07-27 |
| Organism: | S.lycopersicum S.habrochaites S.pennellii S.pimpinellifolium S.peruvianum S.cheesmaniae S.lycopersicoides |
| Alternative ID: | 346531 |
| mRNA sequence: | Length: 201 bp |
>SGN-U346531 Tomato 200607 #1 (1 members)
GAGATTAACAAAGATAGAAATTTCNCATTTTGAGAAAAAAAAAGGAGATGGCTATTGCTGGTCATTGGGCATTTGTTTTTGGTGTCCTTG
GAAATATTATCTCGTTTATTGTTTTCCTTTCTCCAATACCAACATTTAATAAAATTTACAAGAAGAAATCAACTGAAGGATATCAATCAA
TTCCATACGTGATTGCNTCTC
[Blast] [AA Translation]
| Associated Loci (0) |
| Genomic locations (0) |
Library representation (1)
|
mRNA member sequences (1)
|
To view details for a particular member sequence, click the SGN-E# identifier.
[Hide Image]
Markers Information (0)
|
Expression Data (0)
|
Annotations (manual: 0 | blast: 2 | go: 2 )
|
Protein prediction analysis (2)
|
Gene Family (3)
|
Preceding Unigenes (1)
|
Library representation (1)
Library representation (1)

