Sol Genomics Network

Unigene SGN-U200412

Unigene Basic Information

Unigene ID:	SGN-U200412
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	200412
mRNA sequence:	Length: 449 bp

>SGN-U200412 Capsicum annuum #1 (1 members)
GTGGTCCGAATGTTGGTGTTACGAGGTTCTTGTTGCCTGCTTCCGAGTGTGAATATACGTTGAATTCGTTGTTAGATGAATTGAGCACAG
ATCAGTGGCCAGTTCCACAAGGGAATAGAGCGTTACGATGCACAGGTGTTGCTTTGAGTGTAGCAGCTGGATTGCTAGGAGCTTGTATGG
CTGGTGCTGGTGCTCGGATCGTGGCTTTAGTGGGAGGTCCTTGCACAGAGGGACCTGGGGCGATTGTGTCGAAAGATCTAACAGAACCAG
TTCGCCCTCATAAGGATCTTCACAAGGATGCAGCACCTTTTCTTAAAAAGGCAGCTCATTTCTACGAGGAACTCGCAAAACAGCTTGTTA
CTCAAGGTCATGTCTTGGATGTGTTTGCTTCAGCACTTGATCAGGTTGGGGTTGCTGAGATGAAAGTAGCTATTGAAAAAACAGGAGGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS11	Early root	2168	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E507510
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	287	zf-Sec23_Sec24 Sec23_trunk Sec23_helical	54
2	22613	zf-Sec23_Sec24 Sec23_trunk Sec23_helical	23
5	56756	zf-Sec23_Sec24 Sec23_trunk Sec23_helical	23
1.1	101719	Sec23/Sec24 beta-sandwich Sec23/Sec24 trunk region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127) Zinc finger Sec23/Sec24-type - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Molecular Function: zinc ion binding (GO:0008270) - Cellular Component: COPII vesicle coat (GO:0030127)	43
2	119218	Sec23/Sec24 beta-sandwich Zinc finger Sec23/Sec24-type - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Molecular Function: zinc ion binding (GO:0008270) - Cellular Component: COPII vesicle coat (GO:0030127) Sec23/Sec24 trunk region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127) Gelsolin region Sec23/Sec24 helical region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127)	18
5	129564	Sec23/Sec24 beta-sandwich Zinc finger Sec23/Sec24-type - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Molecular Function: zinc ion binding (GO:0008270) - Cellular Component: COPII vesicle coat (GO:0030127) Sec23/Sec24 trunk region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127) Gelsolin region Sec23/Sec24 helical region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127)	18

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: