Sol Genomics Network

Unigene SGN-U208340

Unigene Basic Information

Unigene ID:	SGN-U208340
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	208340
mRNA sequence:	Length: 693 bp

>SGN-U208340 Petunia hybrida #1 (3 members)
GTGAGAGGTTTCCTGTTCCAAGACTTGTAGTGTGTGATCAACATGGCTCCCAGGCAAGATTCCTTTTGGCGAAGTTGAATCCGTCGGCCA
CGTATAACAATGCAAATAATATGGCAGCCGGATCCGACGTGATCTTCACTGATGATGTGAGTCTTCAAGTGTTCTTTGAGCATCTTCAGC
GGCTAGCAGTGCAGTCTTCTTGACAAGAGAAGAAAGAATGGGGCTTTACTGTTAATGCTTGTCCCCTTTATGTGAAAATCTTTTTGAGTT
TCCTTCATCTGCCCTGCCAACCTCTTGTCGAAAGTTCACAATTACTTCCCATCATCCATAAGATGAGAGGTCAGACCCAGACATTATTTG
GAAAACTAGGAGTACATTTGACATTCTTTCAGGTATGGGGAGGTACTTTTGCTTCCTGAAAATAAAGGGTAATGCGACTCTTTGTTCTCG
TTTTAGTTATATAAGAAGGGGGTTATGTTTTAAGTTAAATGGCATGTTTGCTCCCTCAGGCTATTGAGTGAGAAGATAGTTTATGTCGGC
GACTTTTTTTTGGTTAGTAATTACCAGGCAAAGATTTTGTGTTTGCTTTTATTTCGAATTCATAGCTGTAGTTGATTGATTAAGGCTTGT
AGGTCAGGAAGTCTGTGAAAACATTAGCTTATTTCGTGCTTCATTCATAAATTAAAGTATCAT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (2)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-C2H4	all floral organs anthesis	3072	2
Petunia x hybrida	Petunia-YF	whole fruit (ovary) several	947	1

mRNA member sequences (3)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	287	zf-Sec23_Sec24 Sec23_trunk Sec23_helical	54
2	22613	zf-Sec23_Sec24 Sec23_trunk Sec23_helical	23
5	56756	zf-Sec23_Sec24 Sec23_trunk Sec23_helical	23
1.1	101719	Sec23/Sec24 beta-sandwich Sec23/Sec24 trunk region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127) Zinc finger Sec23/Sec24-type - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Molecular Function: zinc ion binding (GO:0008270) - Cellular Component: COPII vesicle coat (GO:0030127)	43
2	119218	Sec23/Sec24 beta-sandwich Zinc finger Sec23/Sec24-type - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Molecular Function: zinc ion binding (GO:0008270) - Cellular Component: COPII vesicle coat (GO:0030127) Sec23/Sec24 trunk region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127) Gelsolin region Sec23/Sec24 helical region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127)	18
5	129564	Sec23/Sec24 beta-sandwich Zinc finger Sec23/Sec24-type - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Molecular Function: zinc ion binding (GO:0008270) - Cellular Component: COPII vesicle coat (GO:0030127) Sec23/Sec24 trunk region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127) Gelsolin region Sec23/Sec24 helical region - Molecular Function: protein binding (GO:0005515) - Biological Process: intracellular protein transport (GO:0006886) - Biological Process: ER to Golgi vesicle-mediated transport (GO:0006888) - Cellular Component: COPII vesicle coat (GO:0030127)	18

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL: